Seq ID Score (bits) Sequence
AB005257.1 0.00 .AAAUCGCGCUUUCCCCACGCCAAAUCACAGAUCUAGGCGUGAACAACCAAAUGACCUGCUGACCCCCAGCGAUUGCCUGGCGACAGCACGGUCGCAUGCAUGUGAUGAAACAUGCCAAUUUUCA GGAAGCCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGCUUCCUUUCUUUUCUGUCUCUGUUUAGAUUAUUUUAAUCACCAUUUAAAAUUGAUUUAAUCAGAAGC
..................................................................................................<<<<........>>>>.......... ..<<<<...<.<<.<<<<.....>>..>>.>>...>.>>>>.. ..............................................................
AB033998.1 0.00 .UUUGAUAGUGUGGAUCAUCUCGAACGCGAAAGAGAAGACCUAAUGAGGAGGCUCAGAGAUCUAGACCUCCGGCGCUUUCAGAUCUAAGCGCCACCACACUGGGUAACUGACUACAGUUGAGAAGGGGUGGACCGUAAACCACUGGUUGGCUGACUACAGCAACUGA CUUUCCCGAGGCCACGGCGAGUAGCAUCGAGGGUACAGGAAAGCUGGGACCAUUGCAUAGUCAACUAAUUUGGCUGU
..................................................................................................................................<<<<........>>>>.................... .........<.<<.<<<<.....>>..>>.>>...>....... ..................................
AB046864.1 0.00 .GAGAAGAUCUUAUGAGGAGGUUAAGAGACCUAGACCUCCGGCGCUUUCAGAUCUAAGCGCCCCACACUGGUUAACUGACUACAGUUGAGAAGGGGUGGACCGUAAACCACUGGCUGGCUGACUACAGCAACUGA CUUUCCCGAGGCCACGGCGAGUAGCAUCGAGGGUACAGGAAUGUUGGGACCAUUGUGUGAUCAACUAAUUUGGUUGCACUAGGGGAACCAAUGGGGUGGUAGGUCAAUC
...................................................................................................<<<........>>>..................... .........<.<<.<<<<.....>>..>>.>>...>....... ..................................................................
AF056197.1 0.00 .UCACUACGGGGGUUACCCCUAGUGUAGCAUGGGCCGAGGCGUGCAGGCAAGCACGCAAAGCAAGCAGGAAAGUGAAUCGAAGCUCCCUGCCUGCUCCCACUCUU GAGAGCCGAGGCCACGCCGAGUAGGAUCGAGGGUACAGCUCUCCUCCUUUUCUGUCUCUGUUUAGAUUAUUUUAAUCAACAUUU
........................................................................................................ ..<<<<...<.<<.<<<<.....>>..>>.>>...>.>>>>.. .........................................
AF111995.1 0.00 .AUCGUAGAAGUUCAAUAGUAAGAGUUAAGGAAGAUAGGCAUGUAGCUUAGCACCUACAUGUCUAUCGCCAGGGAAAUGUCUAAUCUGUCUACUUAGUAGCCUGGAAACGAACGGUAGGCCCUUAGAUUUUAACUUAGUUUAAUUUUUAGUUUAGUUUAAGUUAGUUUAGAGUAGGUAUAAAGAUGC CAGUGCCGGGGCCACGCGGCGUACGAUCGUGGGUACAGCACUAGGACGCCCACUAGG
.......................................................................................................................................<<<<........>>>>................................... .<<<<<...<.<<.<<<<.....>>..>>.>>...>.>>>>>. ..............
AF111997.1 0.00 .AUCUUAGAAGAUCAUUAGUUAGAGUUAAGGAAGAUAGGCAUGUAGCUUAGCACCUACAUGUCUAUCGCCAGGGAAAUGUCUAAUCUGUCUACUUAGUAGCCUGGAAACGAACGGUAGACCCUUAGAUUUUAAUUUAGUUUAAUUUUUAGUUUAGUUUAAGUUAGUUUAGAGUAGGUAUAAAGAUGC CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACAAGGACGCCCAUUAGG
.......................................................................................................................................<<<<........>>>>................................... ..<<<<...<.<<.<<<<.....>>..>>.>>...>.>>>>.. ..............
AF203002.1 0.00 .UUAGUAGCCUGGAAACGAACGGUAGACCCUUAGAUUUUAAUUUAGUUUAUUUUUUAGUUUAGUUUAAGUUAGUUUAGAGUAGGUAUAAAGAUGC CAGUGCCGAGGCCACGCGGAGUACGAUCGAGGGUACAGCACUAGGACGCCCACUAGGGGAAGAGCUAAAUUUUAGUUUAAGUUAAGUUUAAUUGGCUAAGUAUAGUUAAAAUUUAUAGGCUAGUAUAGAGUUAGAGC
...........................................<<<<........>>>>................................... .<<<<<...<.<<.<<<<.....>>..>>.>>...>.>>>>>. ..............................................................................................
AF260508.1 0.00 .UGCAGCAUGGUCCCAUGCGUGCGAACAAGCACGCAGAGCAGGUGACAAUCAUGACCUGCAACUAUCU GGAAGCCGCGACCACGCCGAGUAGGAUCGAGGGUACAGCUUCCUAUCCUUCUUUUCUGUCUCUGUUUAGAUUAUUUUAAUCACCAUUUAAAAUUGAUUUAAUCAGAUGC
................................................................... <<<<<<...<.<<.<<<<.....>>..>>.>>...>.>>>>>> ..................................................................
AJ278335.1 0.00 .UAGUAGCCUGGAAACGAACGGUAGACCCUUAGAUUUUAAUUUAGUUUAAUUUUUAGUUUAGUUUAAGUUAGUUUAGAGUAGGUAUAAAGAAGC CAGUGCCAGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUAGGACGCCCACUAGGGGAAGAGCUAAAUUUUAGUUUAAGUUAAGUUUAAUUGGCUAGGUAUAGUUAAAAUUUAUAGGCUAGUAUAGAGUUAGAGCAAAAAAAAAA
..........................................<<<<........>>>>................................... .<<<<<...<.<<.<<<<.....>>..>>.>>...>.>>>>>. ........................................................................................................
AJ278336.1 0.00 .UAAUUUAGUUUAAUUUUUAGUUUAGUUUAAGUUAGUUUAGAGUAGGUAUAAAGAAGC CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUAGGACGCCCACUAGGGGAAGAGCUAAAUUUUAGUUUAAGUUAAGUUUAAUUGGCUAAGUAUAGUUAAAAUUUAUAGGCUAGUAUAGAGUUAGAGCAAAAAAAAAA
......<<<<........>>>>................................... .<<<<<...<.<<.<<<<.....>>..>>.>>...>.>>>>>. ........................................................................................................
AY044186.1 0.00 .GUAAAAUUCAAUAGUAAGAGUUAAGGAAGAUAGGCAUGUAGCUUGAUUACCUACAUGUCUAUCGCCAGGGAAAUGUCUAAUUUGUCUACUUAGUAGCCUGGAAACGAACGGUAGACCCUUAGAUUUUAAUUUAGUUUAAUUUUUAGUUUAGUUUAAGUUAGUUUAGAGUAGGUAUAAAGAUGC CAGUGCCGGGGCCACGCUGAGUACGACCGAGGGUACAGCACUAGGACGCCC
....................................................................................................................................<<<<........>>>>................................... .<<<<<...<.<<.<<<.......>..>>.>>...>.>>>>>. ........
L06252.1 0.00 .AGUUUAGAGUAGGUAUAAAGAUGC CAGUGCCAGGGCCACGCGGAGUACGAUCGAGGGUACAGCACCAGGACGCCCAUUAGGGGAAGAGCUAAAUUUUAGUUUAAGUUAAGUUUAAUUGGCUAAGUAUAGUUAAAAUUUAUAGGCUAGUAUAGAGUUAGAGC
........................ ..<<<<...<.<<.<<<<.....>>..>>.>>...>.>>>>.. ..............................................................................................
M28566.1 0.00 .UUGAGUAAAAUUCAAUAGUAAGAGUUAAGGAAGAUAGGCAUGUAGCUUGAUUACCUACAUGUCUAUCGCCAGGGAAAUGUCUAAUCUGUCUACUUAGUAGCCUGGAAACGAACGGUAGACCCUUAGAUUUUAAUUUAGUUUAAUUUUUAGUUUAGUUUAAGUUAGUUUAGAGUAGGUAUAAAGAUGC CAGUGCCGGGGCCACGCGGAGUACGACCGAGGGUACAGCACUAGGACGCCCAUUAG
........................................................................................................................................<<<<........>>>>................................... .<<<<<...<.<<.<<<<.....>>..>>.>>...>.>>>>>. .............
U15136.1 0.00 .GAUAAUCAUGACCUACAAACUUCAG GA-AGCCGCGCCCACGCCGAGUAGGAUCGAGGGUACAG---UC
......................... ....<<...<.<<.<<<<.....>>..>>.>>...>.>...>.
U52594.1 0.00 .AACGAACAGUAGACCCUUAGAUUUUAAUUUAGUUUAAUUUUUAGUUUAGUUUAAGUUAGUUUAGAGUAGGUUUAAAGAUGC CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUUGGACGCCCAUUAUGGGAAGAGCUAAAUUUUAGUUUAAGUUAAGUUUAAUUGGCUAAGUAUAGUUAAAAUUUUUAGGCUAGUAUAGAGUUAGAGC
..............................<<<<........>>>>................................... .<<<<<...<.<<.<<<<.....>>..>>.>>...>.>>>>>. ..............................................................................................
U52600.1 0.00 .GUCUACUGAGUAGCCUGGAAAUGAAAGGUAGACCCUUAGAUUCUAAUUUAGUUUAUUUUAGUUUAUUUUAAGUUAGUUUAGAGUAGUUAGAAAGAAGC CAGUGCCGAGGCCACUCGGAGUACGAUCGAGGGUACAGCACUAGGACGCCCACUAGGGGAAGAGCUAAAUGUAGUUUAAUUUUAAGUUAAGUAAAUUAGUAUAGUUAGUUUCAUUAGGCUAGUAUAGAGUUAGAGC
.................................................<<<<......>>>>................................... .<<<<<...<.<<.<.<<.....>>...>.>>...>.>>>>>. .............................................................................................
X96871.1 0.00 .CUUGGCGGUUCAUCUUGGACCGCUGGAGUACGCGAGGCUUUUCCGCCCAUUUGUGGAAGUUGGGUACUGCGUGCGUGCCUUCGGGGACGCGCGCAGAGCUUGGCUCCGCAAUUUUGACUUGUGAGUUGUUCCCUACCAGAUACCCCAGAUUUACCCGUUACCCUAAAAUUCCCUCCCCUUCCUCUUC ACUCGCCGAGGCCACGCCGAGUAGGACCGAGGGUACAGCGAGUCUUUUAGCUUAAG
......................................................................................................................................<.<..........>.>..................................... <<<<<<...<.<<.<<<<.....>>..>>.>>...>.>>>>>> .............
Y08629.1 0.00 .GGAGCGCGCAACAAGGAUCACCAAACGUGCGUUCCCCACUAGCGCUGAUAAAACAAAGCGCAGUGUAUACAUGGACCUGCUUGCAUCUGGUCUUUCACCAGGCAAUGCAUGGUCACAUGCGUGCGAAGAGGCACGCAUCAUGGGCACUAAUCAAAUGCCUAAUGUUUCU GGAGACCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGUCUCCAUUUCUUUUCUGUCUCUGUUUAGAUUAUUUU
.......................................................................................................................<<<<........>>>>.................................. <<<<<<...<.<<.<<<<.....>>..>>.>>...>.>>>>>> ...............................
Y15936.2 0.00 .GAGUCAGAUAUUUCAUCUCUUUUUGCACCAGAUGAAGUGGACUGGAAAUUUAAAAUUGAGGCCUCCUCGUCAAGGCAUCUUGAGGAGGAACUCCAGUUUUGGAAAUCUAAAGCAACACAGCUGAUGCUUGAGAAAAAU UGAUGCCGAGGCCACGCCGGGUAGGAUCGAGGGUACAGCAUCGGUGCACUAACUUAGUUAGCGCACCACUAAUCAAAAGGAAAAAUUUUUAAGGGUUUUUUUUUC
..................................................................................<<............>>........................................ <<<<<<...<.<<.<<<<.....>>..>>.>>...>.>>>>>> ..............................................................
Y15937.2 0.00 .ACGCCCUUACAGCAAAUCUAUGAGGGCGUACGCGGCCUUCGUGGCCACGCAGAAGCGGUUGCCGUUGUAAAAUCACUU CAAUCCCGAGGCCACGCCGAGUAGGAUCGAGGGUACAGGAUUGUUUGAUUUUUUAAUCAAUUAAUUCAGAUUUAUUAAUUGGC
...........................................<<<..........>>>................... .........<.<<.<<<<.....>>..>>.>>...>....... ........................................
Y15938.2 0.00 .ACAGCCUGAUUGCGGGUUGCGGCCCCAGCAGUGCUUGGUCCGAAGCGUGCAAAGCUGCACGUAAGGUUUCCUUUAAGGAACCCAUUUCU GAAAGCCGAGGCCACGCCGAGUAGGAACGAGGGUACAGCUUUCAAUUUCUUUUCUGUCUCUUUUUAGAUUAGUCUAAUUAGCAUUAGAAUUGAUUUAAUUAGAAGC
.............................................<<<<........>>>>............................ <<<<<<...<.<<.<<<<.....>>..>>.>>...>.>>>>>> ...............................................................
Z11682.1 0.00 .AACUCUCGUAAACCAAGGAAUGACAAUGACGCGUGCCACAAGGAUAGCAAGGCGCGCAUUCCCCACGCUUUCCGAUAGGAUCAAGCGUGGAGUAUACAUGGACCUGCUUGUCUCGGGGGCAAGCCCAGGCAAUGCAUGGUCCCAUGCGUGUGAAGAAGCACGCAAAGCAGCAGGGGAAAUCAAUCCCUGCACAUCU GGAAGCCGCGGCCACGCCGAGUAGGAACGAGGGUACAGCUUCCUUCU
..................................................................................................................................................<<<<........>>>>.................................. <<<<<<...<.<<.<<<<.....>>..>>.>>...>.>>>>>> ....
Z33883.1 0.00 .CAAUGUUGAGUGGGGAAGUGGUGAACAAUCAACAAGCCAGCACAUCCAGGAAAUUUCCUCAGAUGAUGUUGGCGCAGGAGCACACUAUUCGUGUGUAUGUGAGCGCAAACAACAGUCGCUCAAUCAA GGGAGCCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGCUCCCAUUCUUUUCUGUUUCUGUUUAGAUGAUUUAAUCAACAUUUAAAAUUGAUUUAAUCAGAAGC
................................................................................<<<<.......>>>>................................ <<<<<<...<.<<.<<<<.....>>..>>.>>...>.>>>>>> .............................................................