Seq ID Score (bits) Sequence
AB005257.1 0.00 GGAAGCCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGCUUCC
<<<<<<.....<<.<<<<.....>>..>>.>>.....>>>>>>
AB033998.1 0.00 CUUUCCCGAGGCCACGGCGAGUAGCAUCGAGGGUACAGGAAAG
<<<<<<.....<<.<<<<.....>>..>>.>>.....>>>>>>
AB046864.1 0.00 CUUUCCCGAGGCCACGGCGAGUAGCAUCGAGGGUACAGGAAUG
<.<<<<.....<<.<<<<.....>>..>>.>>.....>>>>.>
AF056197.1 0.00 GAGAGCCGAGGCCACGCCGAGUAGGAUCGAGGGUACAGCUCUC
<<<<<<.....<<.<<<<.....>>..>>.>>.....>>>>>>
AF111995.1 0.00 CAGUGCCGGGGCCACGCGGCGUACGAUCGUGGGUACAGCACUA
.<<<<<.....<<.<<<<.....>>..>>.>>.....>>>>>.
AF111997.1 0.00 CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACAA
..<<<<.....<<.<<<<.....>>..>>.>>.....>>>>..
AF203002.1 0.00 CAGUGCCGAGGCCACGCGGAGUACGAUCGAGGGUACAGCACUA
.<<<<<.....<<.<<<<.....>>..>>.>>.....>>>>>.
AF260508.1 0.00 GGAAGCCGCGACCACGCCGAGUAGGAUCGAGGGUACAGCUUCC
<<<<<<.....<<.<<<<.....>>..>>.>>.....>>>>>>
AJ278335.1 0.00 CAGUGCCAGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUA
.<<<<<.....<<.<<<<.....>>..>>.>>.....>>>>>.
AJ278336.1 0.00 CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUA
.<<<<<.....<<.<<<<.....>>..>>.>>.....>>>>>.
AY044186.1 0.00 CAGUGCCGGGGCCACGCUGAGUACGACCGAGGGUACAGCACUA
.<<<<<.....<<.<<<.......>..>>.>>.....>>>>>.
L06252.1 0.00 CAGUGCCAGGGCCACGCGGAGUACGAUCGAGGGUACAGCACCA
..<<<<.....<<.<<<<.....>>..>>.>>.....>>>>..
M28566.1 0.00 CAGUGCCGGGGCCACGCGGAGUACGACCGAGGGUACAGCACUA
.<<<<<.....<<.<<<<.....>>..>>.>>.....>>>>>.
U15136.1 0.00 GA-AGCCGCGCCCACGCCGAGUAGGAUCGAGGGUACAG---UC
....<<.....<<.<<<<.....>>..>>.>>.....>...>.
U52594.1 0.00 CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUU
.<<<<<.....<<.<<<<.....>>..>>.>>.....>>>>>.
U52600.1 0.00 CAGUGCCGAGGCCACUCGGAGUACGAUCGAGGGUACAGCACUA
.<<<<<.....<<.<.<<.....>>...>.>>.....>>>>>.
X96871.1 0.00 ACUCGCCGAGGCCACGCCGAGUAGGACCGAGGGUACAGCGAGU
<<<<<<.....<<.<<<<.....>>..>>.>>.....>>>>>>
Y08629.1 0.00 GGAGACCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGUCUCC
<<<<<<.....<<.<<<<.....>>..>>.>>.....>>>>>>
Y15936.2 0.00 UGAUGCCGAGGCCACGCCGGGUAGGAUCGAGGGUACAGCAUCG
<<<<<<.....<<.<<<<.....>>..>>.>>.....>>>>>>
Y15937.2 0.00 CAAUCCCGAGGCCACGCCGAGUAGGAUCGAGGGUACAGGAUUG
<<<<<<.....<<.<<<<.....>>..>>.>>.....>>>>>>
Y15938.2 0.00 GAAAGCCGAGGCCACGCCGAGUAGGAACGAGGGUACAGCUUUC
<<<<<<.....<<.<<<<.....>>..>>.>>.....>>>>>>
Z11682.1 0.00 GGAAGCCGCGGCCACGCCGAGUAGGAACGAGGGUACAGCUUCC
<<<<<<.....<<.<<<<.....>>..>>.>>.....>>>>>>
Z33883.1 0.00 GGGAGCCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGCUCCC
<<<<<<.....<<.<<<<.....>>..>>.>>.....>>>>>>