Seq ID Score (bits) Sequence
AB005257.1 64.85 GGAAGCCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGCUUCC
<<<<<<....<<<...<<.....>>......>>>...>>>>>>
AB033998.1 57.36 CUUUCCCGAGGCCACGGCGAGUAGCAUCGAGGGUACAGGAAAG
<<<<<<....<<<...<<.....>>......>>>...>>>>>>
AB046864.1 56.50 CUUUCCCGAGGCCACGGCGAGUAGCAUCGAGGGUACAGGAAUG
<.<<<<....<<<...<<.....>>......>>>...>>>>.>
AF056197.1 66.96 GAGAGCCGAGGCCACGCCGAGUAGGAUCGAGGGUACAGCUCUC
<<<<<<....<<<...<<.....>>......>>>...>>>>>>
AF111995.1 60.45 CAGUGCCGGGGCCACGCGGCGUACGAUCGUGGGUACAGCACUA
.<<<<<....<<<...<<.....>>......>>>...>>>>>.
AF111997.1 63.87 CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACAA
..<<<<....<<<...<<.....>>......>>>...>>>>..
AF203002.1 67.58 CAGUGCCGAGGCCACGCGGAGUACGAUCGAGGGUACAGCACUA
.<<<<<....<<<...<<.....>>......>>>...>>>>>.
AF260508.1 61.39 GGAAGCCGCGACCACGCCGAGUAGGAUCGAGGGUACAGCUUCC
<<<<<<....<<<...<<.....>>......>>>...>>>>>>
AJ278335.1 64.56 CAGUGCCAGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUA
.<<<<<....<<<...<<.....>>......>>>...>>>>>.
AJ278336.1 67.43 CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUA
.<<<<<....<<<...<<.....>>......>>>...>>>>>.
AY044186.1 62.00 CAGUGCCGGGGCCACGCUGAGUACGACCGAGGGUACAGCACUA
.<<<<<....<<<...<.......>......>>>...>>>>>.
L06252.1 61.00 CAGUGCCAGGGCCACGCGGAGUACGAUCGAGGGUACAGCACCA
..<<<<....<<<...<<.....>>......>>>...>>>>..
M28566.1 65.19 CAGUGCCGGGGCCACGCGGAGUACGACCGAGGGUACAGCACUA
.<<<<<....<<<...<<.....>>......>>>...>>>>>.
U15136.1 46.90 GA-AGCCGCGCCCACGCCGAGUAGGAUCGAGGGUACAG---UC
<<...<.....<<...<<.....>>......>>....>...>>
U52594.1 64.39 CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUU
.<<<<<....<<<...<<.....>>......>>>...>>>>>.
U52600.1 64.06 CAGUGCCGAGGCCACUCGGAGUACGAUCGAGGGUACAGCACUA
.<<<<<....<<<...<<.....>>......>>>...>>>>>.
X96871.1 56.33 ACUCGCCGAGGCCACGCCGAGUAGGACCGAGGGUACAGCGAGU
<<<<<<....<<<...<<.....>>......>>>...>>>>>>
Y08629.1 59.79 GGAGACCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGUCUCC
<<<<<<....<<<...<<.....>>......>>>...>>>>>>
Y15936.2 60.83 UGAUGCCGAGGCCACGCCGGGUAGGAUCGAGGGUACAGCAUCG
<<<<<<....<<<...<<.....>>......>>>...>>>>>>
Y15937.2 63.94 CAAUCCCGAGGCCACGCCGAGUAGGAUCGAGGGUACAGGAUUG
<<<<<<....<<<...<<.....>>......>>>...>>>>>>
Y15938.2 63.59 GAAAGCCGAGGCCACGCCGAGUAGGAACGAGGGUACAGCUUUC
<<<<<<....<<<...<<.....>>......>>>...>>>>>>
Z11682.1 62.19 GGAAGCCGCGGCCACGCCGAGUAGGAACGAGGGUACAGCUUCC
<<<<<<....<<<...<<.....>>......>>>...>>>>>>
Z33883.1 65.55 GGGAGCCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGCUCCC
<<<<<<....<<<...<<.....>>......>>>...>>>>>>