Seq ID Score (bits) Sequence
AB005257.1 0.00 GGAAGCCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGCUUCC
<<<<<<.<<.>.....<<.<.>.>>.>..........>>>>>>
AB033998.1 0.00 CUUUCCCGAGGCCACGGCGAGUAGCAUCGAGGGUACAGGAAAG
<<<<<<.<........<<.<.>.>>.>..........>>>>>>
AB046864.1 0.00 CUUUCCCGAGGCCACGGCGAGUAGCAUCGAGGGUACAGGAAUG
<.<<<<.<........<<.<.>.>>.>..........>>>>.>
AF056197.1 0.00 GAGAGCCGAGGCCACGCCGAGUAGGAUCGAGGGUACAGCUCUC
<<<<<<.<........<<.<.>.>>.>..........>>>>>>
AF111995.1 0.00 CAGUGCCGGGGCCACGCGGCGUACGAUCGUGGGUACAGCACUA
.<<<<<.<........<<.....>>.>..........>>>>>.
AF111997.1 0.00 CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACAA
..<<<<.<........<<.<.>.>>.>..........>>>>..
AF203002.1 0.00 CAGUGCCGAGGCCACGCGGAGUACGAUCGAGGGUACAGCACUA
.<<<<<.<........<<.<.>.>>.>..........>>>>>.
AF260508.1 0.00 GGAAGCCGCGACCACGCCGAGUAGGAUCGAGGGUACAGCUUCC
<<<<<<.<........<<.<.>.>>.>..........>>>>>>
AJ278335.1 0.00 CAGUGCCAGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUA
.<<<<<.<........<<.<.>.>>.>..........>>>>>.
AJ278336.1 0.00 CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUA
.<<<<<.<........<<.<.>.>>.>..........>>>>>.
AY044186.1 0.00 CAGUGCCGGGGCCACGCUGAGUACGACCGAGGGUACAGCACUA
.<<<<<.<........<..<.>..>.>..........>>>>>.
L06252.1 0.00 CAGUGCCAGGGCCACGCGGAGUACGAUCGAGGGUACAGCACCA
..<<<<.<........<<.<.>.>>.>..........>>>>..
M28566.1 0.00 CAGUGCCGGGGCCACGCGGAGUACGACCGAGGGUACAGCACUA
.<<<<<.<........<<.<.>.>>.>..........>>>>>.
U15136.1 0.00 GA-AGCCGCGCCCACGCCGAGUAGGAUCGAGGGUACAG---UC
<<...<.<........<<.<.>.>>.>..........>...>>
U52594.1 0.00 CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUU
.<<<<<.<........<<.<.>.>>.>..........>>>>>.
U52600.1 0.00 CAGUGCCGAGGCCACUCGGAGUACGAUCGAGGGUACAGCACUA
.<<<<<.<........<<.<.>.>>.>..........>>>>>.
X96871.1 0.00 ACUCGCCGAGGCCACGCCGAGUAGGACCGAGGGUACAGCGAGU
<<<<<<.<........<<.<.>.>>.>..........>>>>>>
Y08629.1 0.00 GGAGACCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGUCUCC
<<<<<<.<<.>.....<<.<.>.>>.>..........>>>>>>
Y15936.2 0.00 UGAUGCCGAGGCCACGCCGGGUAGGAUCGAGGGUACAGCAUCG
<<<<<<.<........<<.<.>.>>.>..........>>>>>>
Y15937.2 0.00 CAAUCCCGAGGCCACGCCGAGUAGGAUCGAGGGUACAGGAUUG
<<<<<<.<........<<.<.>.>>.>..........>>>>>>
Y15938.2 0.00 GAAAGCCGAGGCCACGCCGAGUAGGAACGAGGGUACAGCUUUC
<<<<<<..........<<.<.>.>>............>>>>>>
Z11682.1 0.00 GGAAGCCGCGGCCACGCCGAGUAGGAACGAGGGUACAGCUUCC
<<<<<<..<.>.....<<.<.>.>>............>>>>>>
Z33883.1 0.00 GGGAGCCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGCUCCC
<<<<<<.<<.>.....<<.<.>.>>.>..........>>>>>>