Seq ID Score (bits) Sequence
AB005257.1 0.00 GGAAGCCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGCUUCC
<<<<<............<.....>..............>>>>>
AB033998.1 0.00 CUUUCCCGAGGCCACGGCGAGUAGCAUCGAGGGUACAGGAAAG
<<<<<............<.....>..............>>>>>
AB046864.1 0.00 CUUUCCCGAGGCCACGGCGAGUAGCAUCGAGGGUACAGGAAUG
<.<<<............<.....>..............>>>.>
AF056197.1 0.00 GAGAGCCGAGGCCACGCCGAGUAGGAUCGAGGGUACAGCUCUC
<<<<<............<.....>..............>>>>>
AF111995.1 0.00 CAGUGCCGGGGCCACGCGGCGUACGAUCGUGGGUACAGCACUA
.<<<<............<.....>..............>>>>.
AF111997.1 0.00 CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACAA
..<<<............<.....>..............>>>..
AF203002.1 0.00 CAGUGCCGAGGCCACGCGGAGUACGAUCGAGGGUACAGCACUA
.<<<<............<.....>..............>>>>.
AF260508.1 0.00 GGAAGCCGCGACCACGCCGAGUAGGAUCGAGGGUACAGCUUCC
<<<<<............<.....>..............>>>>>
AJ278335.1 0.00 CAGUGCCAGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUA
.<<<<............<.....>..............>>>>.
AJ278336.1 0.00 CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUA
.<<<<............<.....>..............>>>>.
AY044186.1 0.00 CAGUGCCGGGGCCACGCUGAGUACGACCGAGGGUACAGCACUA
.<<<<.................................>>>>.
L06252.1 0.00 CAGUGCCAGGGCCACGCGGAGUACGAUCGAGGGUACAGCACCA
..<<<............<.....>..............>>>..
M28566.1 0.00 CAGUGCCGGGGCCACGCGGAGUACGACCGAGGGUACAGCACUA
.<<<<............<.....>..............>>>>.
U15136.1 0.00 GA-AGCCGCGCCCACGCCGAGUAGGAUCGAGGGUACAG---UC
<<...............<.....>.................>>
U52594.1 0.00 CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUU
.<<<<............<.....>..............>>>>.
U52600.1 0.00 CAGUGCCGAGGCCACUCGGAGUACGAUCGAGGGUACAGCACUA
.<<<<............<.....>..............>>>>.
X96871.1 0.00 ACUCGCCGAGGCCACGCCGAGUAGGACCGAGGGUACAGCGAGU
<<<<<............<.....>..............>>>>>
Y08629.1 0.00 GGAGACCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGUCUCC
<<<<<............<.....>..............>>>>>
Y15936.2 0.00 UGAUGCCGAGGCCACGCCGGGUAGGAUCGAGGGUACAGCAUCG
<<<<<............<.....>..............>>>>>
Y15937.2 0.00 CAAUCCCGAGGCCACGCCGAGUAGGAUCGAGGGUACAGGAUUG
<<<<<............<.....>..............>>>>>
Y15938.2 0.00 GAAAGCCGAGGCCACGCCGAGUAGGAACGAGGGUACAGCUUUC
<<<<<............<.....>..............>>>>>
Z11682.1 0.00 GGAAGCCGCGGCCACGCCGAGUAGGAACGAGGGUACAGCUUCC
<<<<<............<.....>..............>>>>>
Z33883.1 0.00 GGGAGCCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGCUCCC
<<<<<............<.....>..............>>>>>