Seq ID Score (bits) Sequence
AB005257.1 0.00 GGAAGCCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGCUUCC
.<<<<<....<<<...<<.....>>......>>>...>>>>>.
AB033998.1 0.00 CUUUCCCGAGGCCACGGCGAGUAGCAUCGAGGGUACAGGAAAG
.<<<<<....<<<...<<.....>>......>>>...>>>>>.
AB046864.1 0.00 CUUUCCCGAGGCCACGGCGAGUAGCAUCGAGGGUACAGGAAUG
..<<<<....<<<...<<.....>>......>>>...>>>>..
AF056197.1 0.00 GAGAGCCGAGGCCACGCCGAGUAGGAUCGAGGGUACAGCUCUC
.<<<<<....<<<...<<.....>>......>>>...>>>>>.
AF111995.1 0.00 CAGUGCCGGGGCCACGCGGCGUACGAUCGUGGGUACAGCACUA
.<<<<<....<<<...<<.....>>......>>>...>>>>>.
AF111997.1 0.00 CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACAA
..<<<<....<<<...<<.....>>......>>>...>>>>..
AF203002.1 0.00 CAGUGCCGAGGCCACGCGGAGUACGAUCGAGGGUACAGCACUA
.<<<<<....<<<...<<.....>>......>>>...>>>>>.
AF260508.1 0.00 GGAAGCCGCGACCACGCCGAGUAGGAUCGAGGGUACAGCUUCC
.<<<<<....<<<...<<.....>>......>>>...>>>>>.
AJ278335.1 0.00 CAGUGCCAGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUA
.<<<<<....<<<...<<.....>>......>>>...>>>>>.
AJ278336.1 0.00 CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUA
.<<<<<....<<<...<<.....>>......>>>...>>>>>.
AY044186.1 0.00 CAGUGCCGGGGCCACGCUGAGUACGACCGAGGGUACAGCACUA
.<<<<<....<<<...<.......>......>>>...>>>>>.
L06252.1 0.00 CAGUGCCAGGGCCACGCGGAGUACGAUCGAGGGUACAGCACCA
..<<<<....<<<...<<.....>>......>>>...>>>>..
M28566.1 0.00 CAGUGCCGGGGCCACGCGGAGUACGACCGAGGGUACAGCACUA
.<<<<<....<<<...<<.....>>......>>>...>>>>>.
U15136.1 0.00 GA-AGCCGCGCCCACGCCGAGUAGGAUCGAGGGUACAG---UC
....<<.....<<...<<.....>>......>>....>...>.
U52594.1 0.00 CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUU
.<<<<<....<<<...<<.....>>......>>>...>>>>>.
U52600.1 0.00 CAGUGCCGAGGCCACUCGGAGUACGAUCGAGGGUACAGCACUA
.<<<<<....<<<...<<.....>>......>>>...>>>>>.
X96871.1 0.00 ACUCGCCGAGGCCACGCCGAGUAGGACCGAGGGUACAGCGAGU
.<<<<<....<<<...<<.....>>......>>>...>>>>>.
Y08629.1 0.00 GGAGACCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGUCUCC
.<<<<<....<<<...<<.....>>......>>>...>>>>>.
Y15936.2 0.00 UGAUGCCGAGGCCACGCCGGGUAGGAUCGAGGGUACAGCAUCG
.<<<<<....<<<...<<.....>>......>>>...>>>>>.
Y15937.2 0.00 CAAUCCCGAGGCCACGCCGAGUAGGAUCGAGGGUACAGGAUUG
.<<<<<....<<<...<<.....>>......>>>...>>>>>.
Y15938.2 0.00 GAAAGCCGAGGCCACGCCGAGUAGGAACGAGGGUACAGCUUUC
.<<<<<....<<<...<<.....>>......>>>...>>>>>.
Z11682.1 0.00 GGAAGCCGCGGCCACGCCGAGUAGGAACGAGGGUACAGCUUCC
.<<<<<....<<<...<<.....>>......>>>...>>>>>.
Z33883.1 0.00 GGGAGCCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGCUCCC
.<<<<<....<<<...<<.....>>......>>>...>>>>>.