Seq ID Score (bits) Sequence
AB005257.1 62.22 GGAAGCCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGCUUCC
<<<<<<....<<<...<<.....>>......>>>...>>>>>>
AB033998.1 55.79 CUUUCCCGAGGCCACGGCGAGUAGCAUCGAGGGUACAGGAAAG
<<<<<<....<<<...<<.....>>......>>>...>>>>>>
AB046864.1 53.05 .A CUUUCCCGAGGCCACGGCGAGUAGCAUCGAGGGUACAGGAAUGU
. <.<<<<....<<<...<<.....>>......>>>...>>>>.> >
AF056197.1 62.54 GAGAGCCGAGGCCACGCCGAGUAGGAUCGAGGGUACAGCUCUC
<<<<<<....<<<...<<.....>>......>>>...>>>>>>
AF111995.1 54.13 CAGUGCCGGGGCCACGCGGCGUACGAUCGUGGGUACAGCACUA
_<<<<<....<<<...<<.....>>......>>>...>>>>>_
AF111997.1 55.97 .C CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACAAGG
. <.<<<<....<<<...<<.....>>......>>>...>>>>.. >>
AF203002.1 61.27 CAGUGCCGAGGCCACGCGGAGUACGAUCGAGGGUACAGCACUA
_<<<<<....<<<...<<.....>>......>>>...>>>>>_
AF260508.1 59.28 GGAAGCCGCGACCACGCCGAGUAGGAUCGAGGGUACAGCUUCC
<<<<<<....<<<...<<.....>>......>>>...>>>>>>
AJ278335.1 58.24 CAGUGCCAGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUA
_<<<<<....<<<...<<.....>>......>>>...>>>>>_
AJ278336.1 61.12 CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUA
_<<<<<....<<<...<<.....>>......>>>...>>>>>_
AY044186.1 56.41 CAGUGCCGGGGCCACGCUGAGUACGACCGAGGGUACAGCACUA
_<<<<<....<<<...<.......>......>>>...>>>>>_
L06252.1 51.88 CAGUGCCAGGGCCACGCGGAGUACGAUCGAGGGUACAGCACCA
__<<<<....<<<...<<.....>>......>>>...>>>>__
M28566.1 58.87 CAGUGCCGGGGCCACGCGGAGUACGACCGAGGGUACAGCACUA
_<<<<<....<<<...<<.....>>......>>>...>>>>>_
U15136.1 44.66 GA-AGCCGCGCCCACGCCGAGUAGGAUCGAGGGUACAG---UC
<<...<.....<<...<<.....>>......>>....>...>>
U52594.1 61.12 CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUU
_<<<<<....<<<...<<.....>>......>>>...>>>>>_
U52600.1 57.74 CAGUGCCGAGGCCACUCGGAGUACGAUCGAGGGUACAGCACUA
_<<<<<....<<<...<<.....>>......>>>...>>>>>_
X96871.1 57.66 ACUCGCCGAGGCCACGCCGAGUAGGACCGAGGGUACAGCGAGU
<<<<<<....<<<...<<.....>>......>>>...>>>>>>
Y08629.1 58.07 GGAGACCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGUCUCC
<<<<<<....<<<...<<.....>>......>>>...>>>>>>
Y15936.2 58.54 UGAUGCCGAGGCCACGCCGGGUAGGAUCGAGGGUACAGCAUCG
<<<<<<....<<<...<<.....>>......>>>...>>>>>>
Y15937.2 60.05 CAAUCCCGAGGCCACGCCGAGUAGGAUCGAGGGUACAGGAUUG
<<<<<<....<<<...<<.....>>......>>>...>>>>>>
Y15938.2 59.39 GAAAGCCGAGGCCACGCCGAGUAGGAACGAGGGUACAGCUUUC
<<<<<<....<<<...<<.....>>......>>>...>>>>>>
Z11682.1 59.56 GGAAGCCGCGGCCACGCCGAGUAGGAACGAGGGUACAGCUUCC
<<<<<<....<<<...<<.....>>......>>>...>>>>>>
Z33883.1 62.70 GGGAGCCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGCUCCC
<<<<<<....<<<...<<.....>>......>>>...>>>>>>