Seq ID Score (bits) Sequence
AB005257.1 1.00 .AAAUCGCGCUUUCCCCACGCCAAAUCACAGAUCUAGGCGUGAACAACCAAAUGACCUGCUGACCCCCAGCGAUUGCCUGGCGACAGCACGGUCGCAUGCAUGUGAUGAAACAUGCCAAUUUUCA GGAAGCCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGCUUCCUUUCUUUUCUGUCUCUGUUUAGAUUAUUUUAAUCACCAUUUAAAAUUGAUUUAAUCAGAAGC
...........................................................................................................................< <<<<<<...............................>>>>>> >.............................................................
AB033998.1 1.00 .UUUGAUAGUGUGGAUCAUCUCGAACGCGAAAGAGAAGACCUAAUGAGGAGGCUCAGAGAUCUAGACCUCCGGCGCUUUCAGAUCUAAGCGCCACCACACUGGGUAACUGACUACAGUUGAGAAGGGGUGGACCGUAAACCACUGGUUGGCUGACUACAGCAACUGA CUUUCCCGAGGCCACGGCGAGUAGCAUCGAGGGUACAGGAAAGCUGGGACCAUUGCAUAGUCAACUAAUUUGGCUGU
...................................................................................................................................................................... ........................................... ..................................
AB046864.1 1.00 .GAGAAGAUCUUAUGAGGAGGUUAAGAGACCUAGACCUCCGGCGCUUUCAGAUCUAAGCGCCCCACACUGGUUAACUGACUACAGUUGAGAAGGGGUGGACCGUAAACCACUGGCUGGCUGACUACAGCAACUGA CUUUCCCGAGGCCACGGCGAGUAGCAUCGAGGGUACAGGAAUGUUGGGACCAUUGUGUGAUCAACUAAUUUGGUUGCACUAGGGGAACCAAUGGGGUGGUAGGUCAAUC
...................................................................................................................................... ........................................... ..................................................................
AF056197.1 1.00 .UCACUACGGGGGUUACCCCUAGUGUAGCAUGGGCCGAGGCGUGCAGGCAAGCACGCAAAGCAAGCAGGAAAGUGAAUCGAAGCUCCCUGCCUGCUCCCACUCUU GAGAGCCGAGGCCACGCCGAGUAGGAUCGAGGGUACAGCUCUCCUCCUUUUCUGUCUCUGUUUAGAUUAUUUUAAUCAACAUUU
........................................................................................................ <<<<<<...............................>>>>>> .........................................
AF111995.1 1.00 .AUCGUAGAAGUUCAAUAGUAAGAGUUAAGGAAGAUAGGCAUGUAGCUUAGCACCUACAUGUCUAUCGCCAGGGAAAUGUCUAAUCUGUCUACUUAGUAGCCUGGAAACGAACGGUAGGCCCUUAGAUUUUAACUUAGUUUAAUUUUUAGUUUAGUUUAAGUUAGUUUAGAGUAGGUAUAAAGAUGC CAGUGCCGGGGCCACGCGGCGUACGAUCGUGGGUACAGCACUAGGACGCCCACUAGG
.......................................................................................................................................................................................... ........................................... ..............
AF111997.1 1.00 .AUCUUAGAAGAUCAUUAGUUAGAGUUAAGGAAGAUAGGCAUGUAGCUUAGCACCUACAUGUCUAUCGCCAGGGAAAUGUCUAAUCUGUCUACUUAGUAGCCUGGAAACGAACGGUAGACCCUUAGAUUUUAAUUUAGUUUAAUUUUUAGUUUAGUUUAAGUUAGUUUAGAGUAGGUAUAAAGAUGC CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACAAGGACGCCCAUUAGG
.......................................................................................................................................................................................... ........................................... ..............
AF203002.1 1.00 .UUAGUAGCCUGGAAACGAACGGUAGACCCUUAGAUUUUAAUUUAGUUUAUUUUUUAGUUUAGUUUAAGUUAGUUUAGAGUAGGUAUAAAGAUGC CAGUGCCGAGGCCACGCGGAGUACGAUCGAGGGUACAGCACUAGGACGCCCACUAGGGGAAGAGCUAAAUUUUAGUUUAAGUUAAGUUUAAUUGGCUAAGUAUAGUUAAAAUUUAUAGGCUAGUAUAGAGUUAGAGC
.............................................................................................. .<<<<<...............................>>>>>. ..............................................................................................
AF260508.1 1.00 .UGCAGCAUGGUCCCAUGCGUGCGAACAAGCACGCAGAGCAGGUGACAAUCAUGACCUGCAACUAUCU GGAAGCCGCGACCACGCCGAGUAGGAUCGAGGGUACAGCUUCCUAUCCUUCUUUUCUGUCUCUGUUUAGAUUAUUUUAAUCACCAUUUAAAAUUGAUUUAAUCAGAUGC
................................................................... <<<<<<.<.<.<<.<<...........>>.>>.>.>.>>>>>> ..................................................................
AJ278335.1 1.00 .UAGUAGCCUGGAAACGAACGGUAGACCCUUAGAUUUUAAUUUAGUUUAAUUUUUAGUUUAGUUUAAGUUAGUUUAGAGUAGGUAUAAAGAAGC CAGUGCCAGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUAGGACGCCCACUAGGGGAAGAGCUAAAUUUUAGUUUAAGUUAAGUUUAAUUGGCUAGGUAUAGUUAAAAUUUAUAGGCUAGUAUAGAGUUAGAGCAAAAAAAAAA
............................................................................................. .<<<<.<.<.<<<..................>>>.>.>>>>>. ........................................................................................................
AJ278336.1 1.00 .UAAUUUAGUUUAAUUUUUAGUUUAGUUUAAGUUAGUUUAGAGUAGGUAUAAAGAAGC CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUAGGACGCCCACUAGGGGAAGAGCUAAAUUUUAGUUUAAGUUAAGUUUAAUUGGCUAAGUAUAGUUAAAAUUUAUAGGCUAGUAUAGAGUUAGAGCAAAAAAAAAA
......................................................... .<<<<.<.<.<<<..................>>>.>.>>>>>. ........................................................................................................
AY044186.1 1.00 .GUAAAAUUCAAUAGUAAGAGUUAAGGAAGAUAGGCAUGUAGCUUGAUUACCUACAUGUCUAUCGCCAGGGAAAUGUCUAAUUUGUCUACUUAGUAGCCUGGAAACGAACGGUAGACCCUUAGAUUUUAAUUUAGUUUAAUUUUUAGUUUAGUUUAAGUUAGUUUAGAGUAGGUAUAAAGAUGC CAGUGCCGGGGCCACGCUGAGUACGACCGAGGGUACAGCACUAGGACGCCC
....................................................................................................................................................................................... ........................................... ........
L06252.1 1.00 .AGUUUAGAGUAGGUAUAAAGAUGC CAGUGCCAGGGCCACGCGGAGUACGAUCGAGGGUACAGCACCAGGACGCCCAUUAGGGGAAGAGCUAAAUUUUAGUUUAAGUUAAGUUUAAUUGGCUAAGUAUAGUUAAAAUUUAUAGGCUAGUAUAGAGUUAGAGC
........................ ..<<<<...............................>>>>.. ..............................................................................................
M28566.1 1.00 .UUGAGUAAAAUUCAAUAGUAAGAGUUAAGGAAGAUAGGCAUGUAGCUUGAUUACCUACAUGUCUAUCGCCAGGGAAAUGUCUAAUCUGUCUACUUAGUAGCCUGGAAACGAACGGUAGACCCUUAGAUUUUAAUUUAGUUUAAUUUUUAGUUUAGUUUAAGUUAGUUUAGAGUAGGUAUAAAGAUGC CAGUGCCGGGGCCACGCGGAGUACGACCGAGGGUACAGCACUAGGACGCCCAUUAG
........................................................................................................................................................................................... ........................................... .............
U15136.1 1.00 .GAUAAUCAUGACCUACAAACUUCAG GA-AGCCGCGCCCACGCCGAGUAGGAUCGAGGGUACAG---UC
......................... ...........................................
U52594.1 1.00 .AACGAACAGUAGACCCUUAGAUUUUAAUUUAGUUUAAUUUUUAGUUUAGUUUAAGUUAGUUUAGAGUAGGUUUAAAGAUGC CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUUGGACGCCCAUUAUGGGAAGAGCUAAAUUUUAGUUUAAGUUAAGUUUAAUUGGCUAAGUAUAGUUAAAAUUUUUAGGCUAGUAUAGAGUUAGAGC
................................................................................< <<<<<.<.<.<<<..................>>>.>.>>>>.> >>............................................................................................
U52600.1 1.00 .GUCUACUGAGUAGCCUGGAAAUGAAAGGUAGACCCUUAGAUUCUAAUUUAGUUUAUUUUAGUUUAUUUUAAGUUAGUUUAGAGUAGUUAGAAAGAAGC CAGUGCCGAGGCCACUCGGAGUACGAUCGAGGGUACAGCACUAGGACGCCCACUAGGGGAAGAGCUAAAUGUAGUUUAAUUUUAAGUUAAGUAAAUUAGUAUAGUUAGUUUCAUUAGGCUAGUAUAGAGUUAGAGC
.................................................................................................. .<<<<<...............................>>>>>. .............................................................................................
X96871.1 1.00 .CUUGGCGGUUCAUCUUGGACCGCUGGAGUACGCGAGGCUUUUCCGCCCAUUUGUGGAAGUUGGGUACUGCGUGCGUGCCUUCGGGGACGCGCGCAGAGCUUGGCUCCGCAAUUUUGACUUGUGAGUUGUUCCCUACCAGAUACCCCAGAUUUACCCGUUACCCUAAAAUUCCCUCCCCUUCCUCUUC ACUCGCCGAGGCCACGCCGAGUAGGACCGAGGGUACAGCGAGUCUUUUAGCUUAAG
........................................................................................................................................................................................... ........................................... .............
Y08629.1 1.00 .GGAGCGCGCAACAAGGAUCACCAAACGUGCGUUCCCCACUAGCGCUGAUAAAACAAAGCGCAGUGUAUACAUGGACCUGCUUGCAUCUGGUCUUUCACCAGGCAAUGCAUGGUCACAUGCGUGCGAAGAGGCACGCAUCAUGGGCACUAAUCAAAUGCCUAAUGUUUCU GGAGACCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGUCUCCAUUUCUUUUCUGUCUCUGUUUAGAUUAUUUU
......................................................................................................................................................................... ........................................... ...............................
Y15936.2 1.00 .GAGUCAGAUAUUUCAUCUCUUUUUGCACCAGAUGAAGUGGACUGGAAAUUUAAAAUUGAGGCCUCCUCGUCAAGGCAUCUUGAGGAGGAACUCCAGUUUUGGAAAUCUAAAGCAACACAGCUGAUGCUUGAGAAAAAU UGAUGCCGAGGCCACGCCGGGUAGGAUCGAGGGUACAGCAUCGGUGCACUAACUUAGUUAGCGCACCACUAAUCAAAAGGAAAAAUUUUUAAGGGUUUUUUUUUC
.......................................................................................................................................... ...<<<<<<.<<.........................>>.>>> >>>...........................................................
Y15937.2 1.00 .ACGCCCUUACAGCAAAUCUAUGAGGGCGUACGCGGCCUUCGUGGCCACGCAGAAGCGGUUGCCGUUGUAAAAUCACUU CAAUCCCGAGGCCACGCCGAGUAGGAUCGAGGGUACAGGAUUGUUUGAUUUUUUAAUCAAUUAAUUCAGAUUUAUUAAUUGGC
.............................................................................. ........................................... ........................................
Y15938.2 1.00 .ACAGCCUGAUUGCGGGUUGCGGCCCCAGCAGUGCUUGGUCCGAAGCGUGCAAAGCUGCACGUAAGGUUUCCUUUAAGGAACCCAUUUCU GAAAGCCGAGGCCACGCCGAGUAGGAACGAGGGUACAGCUUUCAAUUUCUUUUCUGUCUCUUUUUAGAUUAGUCUAAUUAGCAUUAGAAUUGAUUUAAUUAGAAGC
........................................................................................< <<<<<<...............................>>>>>> >..............................................................
Z11682.1 1.00 .AACUCUCGUAAACCAAGGAAUGACAAUGACGCGUGCCACAAGGAUAGCAAGGCGCGCAUUCCCCACGCUUUCCGAUAGGAUCAAGCGUGGAGUAUACAUGGACCUGCUUGUCUCGGGGGCAAGCCCAGGCAAUGCAUGGUCCCAUGCGUGUGAAGAAGCACGCAAAGCAGCAGGGGAAAUCAAUCCCUGCACAUCU GGAAGCCGCGGCCACGCCGAGUAGGAACGAGGGUACAGCUUCCUUCU
.................................................................................................................................................................................................... ........................................... ....
Z33883.1 1.00 .CAAUGUUGAGUGGGGAAGUGGUGAACAAUCAACAAGCCAGCACAUCCAGGAAAUUUCCUCAGAUGAUGUUGGCGCAGGAGCACACUAUUCGUGUGUAUGUGAGCGCAAACAACAGUCGCUCAAUCAA GGGAGCCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGCUCCCAUUCUUUUCUGUUUCUGUUUAGAUGAUUUAAUCAACAUUUAAAAUUGAUUUAAUCAGAAGC
............................................................................................................................... <<<<<<...............................>>>>>> .............................................................