Seq ID Score (bits) Sequence
AB005257.1 0.00 .AAATCGCGCTTTCCCCACGCCAAATCACAGATCTAGGCGTGAACAACCAAATGACCTGCTGACCCCCAGCGATTGCCTGGCGACAGCACGGTCGCATGCATGTGATGAAACATGCCAATTTTCA GGAAGCCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGCUUCCTTTCTTTTCTGTCTCTGTTTAGATTATTTTAATCACCATTTAAAATTGATTTAATCAGAAGC
...........................................................................................................................< <<<<<<...............................>>>>>> >.............................................................
AB033998.1 0.00 .TTTGATAGTGTGGATCATCTCGAACGCGAAAGAGAAGACCTAATGAGGAGGCTCAGAGATCTAGACCTCCGGCGCTTTCAGATCTAAGCGCCACCACACTGGGTAACTGACTACAGTTGAGAAGGGGTGGACCGTAAACCACTGGTTGGCTGACTACAGCAACTGA CUUUCCCGAGGCCACGGCGAGUAGCAUCGAGGGUACAGGAAAGCTGGGACCATTGCATAGTCAACTAATTTGGCTGT
...................................................................................................................................................................... <<<<<<...............................>>>>>> ..................................
AB046864.1 0.00 .GAGAAGATCTTATGAGGAGGTTAAGAGACCTAGACCTCCGGCGCTTTCAGATCTAAGCGCCCCACACTGGTTAACTGACTACAGTTGAGAAGGGGTGGACCGTAAACCACTGGCTGGCTGACTACAGCAACTGA CUUUCCCGAGGCCACGGCGAGUAGCAUCGAGGGUACAGGAAUGTTGGGACCATTGTGTGATCAACTAATTTGGTTGCACTAGGGGAACCAATGGGGTGGTAGGTCAATC
..................................................................................................................................<<<< <<<<<<...............................>>>>>> >>>>..............................................................
AF056197.1 0.00 .TCACTACGGGGGTTACCCCTAGTGTAGCATGGGCCGAGGCGTGCAGGCAAGCACGCAAAGCAAGCAGGAAAGTGAATCGAAGCTCCCTGCCTGCTCCCACTCTT GAGAGCCGAGGCCACGCCGAGUAGGAUCGAGGGUACAGCUCUCCTCCTTTTCTGTCTCTGTTTAGATTATTTTAATCAACATTT
........................................................................................................ <<<<<<...............................>>>>>> .........................................
AF111995.1 0.00 .ATCGTAGAAGTTCAATAGTAAGAGTTAAGGAAGATAGGCATGTAGCTTAGCACCTACATGTCTATCGCCAGGGAAATGTCTAATCTGTCTACTTAGTAGCCTGGAAACGAACGGTAGGCCCTTAGATTTTAACTTAGTTTAATTTTTAGTTTAGTTTAAGTTAGTTTAGAGTAGGTATAAAGATGC CAGUGCCGGGGCCACGCGGCGUACGAUCGUGGGUACAGCACUAGGACGCCCACTAGG
.......................................................................................................................................................................................... .<<<<<...............................>>>>>. ..............
AF111997.1 0.00 .ATCTTAGAAGATCATTAGTTAGAGTTAAGGAAGATAGGCATGTAGCTTAGCACCTACATGTCTATCGCCAGGGAAATGTCTAATCTGTCTACTTAGTAGCCTGGAAACGAACGGTAGACCCTTAGATTTTAATTTAGTTTAATTTTTAGTTTAGTTTAAGTTAGTTTAGAGTAGGTATAAAGATGC CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACAAGGACGCCCATTAGG
.......................................................................................................................................................................................... ..<<<<...............................>>>>.. ..............
AF203002.1 0.00 .TTAGTAGCCTGGAAACGAACGGTAGACCCTTAGATTTTAATTTAGTTTATTTTTTAGTTTAGTTTAAGTTAGTTTAGAGTAGGTATAAAGATGC CAGUGCCGAGGCCACGCGGAGUACGAUCGAGGGUACAGCACUAGGACGCCCACTAGGGGAAGAGCTAAATTTTAGTTTAAGTTAAGTTTAATTGGCTAAGTATAGTTAAAATTTATAGGCTAGTATAGAGTTAGAGC
.............................................................................................. .<<<<<...............................>>>>>. ..............................................................................................
AF260508.1 0.00 .TGCAGCATGGTCCCATGCGTGCGAACAAGCACGCAGAGCAGGTGACAATCATGACCTGCAACTATCT GGAAGCCGCGACCACGCCGAGUAGGAUCGAGGGUACAGCUUCCTATCCTTCTTTTCTGTCTCTGTTTAGATTATTTTAATCACCATTTAAAATTGATTTAATCAGATGC
................................................................... <<<<<<...............................>>>>>> ..................................................................
AJ278335.1 0.00 .TAGTAGCCTGGAAACGAACGGTAGACCCTTAGATTTTAATTTAGTTTAATTTTTAGTTTAGTTTAAGTTAGTTTAGAGTAGGTATAAAGAAGC CAGUGCCAGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUAGGACGCCCACTAGGGGAAGAGCTAAATTTTAGTTTAAGTTAAGTTTAATTGGCTAGGTATAGTTAAAATTTATAGGCTAGTATAGAGTTAGAGCAAAAAAAAAA
............................................................................................. .<<<<<...............................>>>>>. ........................................................................................................
AJ278336.1 0.00 .TAATTTAGTTTAATTTTTAGTTTAGTTTAAGTTAGTTTAGAGTAGGTATAAAGAAGC CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUAGGACGCCCACTAGGGGAAGAGCTAAATTTTAGTTTAAGTTAAGTTTAATTGGCTAAGTATAGTTAAAATTTATAGGCTAGTATAGAGTTAGAGCAAAAAAAAAA
......................................................... .<<<<<...............................>>>>>. ........................................................................................................
AY044186.1 0.00 .GTAAAATTCAATAGTAAGAGTTAAGGAAGATAGGCATGTAGCTTGATTACCTACATGTCTATCGCCAGGGAAATGTCTAATTTGTCTACTTAGTAGCCTGGAAACGAACGGTAGACCCTTAGATTTTAATTTAGTTTAATTTTTAGTTTAGTTTAAGTTAGTTTAGAGTAGGTATAAAGATGC CAGUGCCGGGGCCACGCUGAGUACGACCGAGGGUACAGCACUAGGACGCCC
....................................................................................................................................................................................... .<<<<<...............................>>>>>. ........
L06252.1 0.00 .AGTTTAGAGTAGGTATAAAGATGC CAGUGCCAGGGCCACGCGGAGUACGAUCGAGGGUACAGCACCAGGACGCCCATTAGGGGAAGAGCTAAATTTTAGTTTAAGTTAAGTTTAATTGGCTAAGTATAGTTAAAATTTATAGGCTAGTATAGAGTTAGAGC
........................ ..<<<<...............................>>>>.. ..............................................................................................
M28566.1 0.00 .TTGAGTAAAATTCAATAGTAAGAGTTAAGGAAGATAGGCATGTAGCTTGATTACCTACATGTCTATCGCCAGGGAAATGTCTAATCTGTCTACTTAGTAGCCTGGAAACGAACGGTAGACCCTTAGATTTTAATTTAGTTTAATTTTTAGTTTAGTTTAAGTTAGTTTAGAGTAGGTATAAAGATGC CAGUGCCGGGGCCACGCGGAGUACGACCGAGGGUACAGCACUAGGACGCCCATTAG
........................................................................................................................................................................................... .<<<<<...............................>>>>>. .............
U15136.1 0.00 .GATAATCATGACCTACAAACTTCAG GA-AGCCGCGCCCACGCCGAGUAGGAUCGAGGGUACAG---UC
......................... ...........................................
U52594.1 0.00 .AACGAACAGTAGACCCTTAGATTTTAATTTAGTTTAATTTTTAGTTTAGTTTAAGTTAGTTTAGAGTAGGTTTAAAGATGC CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUUGGACGCCCATTATGGGAAGAGCTAAATTTTAGTTTAAGTTAAGTTTAATTGGCTAAGTATAGTTAAAATTTTTAGGCTAGTATAGAGTTAGAGC
................................................................................. .<<<<<...............................>>>>>. ..............................................................................................
U52600.1 0.00 .GTCTACTGAGTAGCCTGGAAATGAAAGGTAGACCCTTAGATTCTAATTTAGTTTATTTTAGTTTATTTTAAGTTAGTTTAGAGTAGTTAGAAAGAAGC CAGUGCCGAGGCCACUCGGAGUACGAUCGAGGGUACAGCACUAGGACGCCCACTAGGGGAAGAGCTAAATGTAGTTTAATTTTAAGTTAAGTAAATTAGTATAGTTAGTTTCATTAGGCTAGTATAGAGTTAGAGC
.................................................................................................. .<<<<<...............................>>>>>. .............................................................................................
X96871.1 0.00 .CTTGGCGGTTCATCTTGGACCGCTGGAGTACGCGAGGCTTTTCCGCCCATTTGTGGAAGTTGGGTACTGCGTGCGTGCCTTCGGGGACGCGCGCAGAGCTTGGCTCCGCAATTTTGACTTGTGAGTTGTTCCCTACCAGATACCCCAGATTTACCCGTTACCCTAAAATTCCCTCCCCTTCCTCTTC ACUCGCCGAGGCCACGCCGAGUAGGACCGAGGGUACAGCGAGUCTTTTAGCTTAAG
........................................................................................................................................................................................... <<<<<<...............................>>>>>> .............
Y08629.1 0.00 .GGAGCGCGCAACAAGGATCACCAAACGTGCGTTCCCCACTAGCGCTGATAAAACAAAGCGCAGTGTATACATGGACCTGCTTGCATCTGGTCTTTCACCAGGCAATGCATGGTCACATGCGTGCGAAGAGGCACGCATCATGGGCACTAATCAAATGCCTAATGTTTCT GGAGACCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGUCUCCATTTCTTTTCTGTCTCTGTTTAGATTATTTT
........................................................................................................................................................................< <<<<<<...............................>>>>>> >..............................
Y15936.2 0.00 .GAGTCAGATATTTCATCTCTTTTTGCACCAGATGAAGTGGACTGGAAATTTAAAATTGAGGCCTCCTCGTCAAGGCATCTTGAGGAGGAACTCCAGTTTTGGAAATCTAAAGCAACACAGCTGATGCTTGAGAAAAAT UGAUGCCGAGGCCACGCCGGGUAGGAUCGAGGGUACAGCAUCGGTGCACTAACTTAGTTAGCGCACCACTAATCAAAAGGAAAAATTTTTAAGGGTTTTTTTTTC
........................................................................................................................................<< <<<<<<...............................>>>>>> >>............................................................
Y15937.2 0.00 .ACGCCCTTACAGCAAATCTATGAGGGCGTACGCGGCCTTCGTGGCCACGCAGAAGCGGTTGCCGTTGTAAAATCACTT CAAUCCCGAGGCCACGCCGAGUAGGAUCGAGGGUACAGGAUUGTTTGATTTTTTAATCAATTAATTCAGATTTATTAATTGGC
.............................................................................. <<<<<<...............................>>>>>> ........................................
Y15938.2 0.00 .ACAGCCTGATTGCGGGTTGCGGCCCCAGCAGTGCTTGGTCCGAAGCGTGCAAAGCTGCACGTAAGGTTTCCTTTAAGGAACCCATTTCT GAAAGCCGAGGCCACGCCGAGUAGGAACGAGGGUACAGCUUUCAATTTCTTTTCTGTCTCTTTTTAGATTAGTCTAATTAGCATTAGAATTGATTTAATTAGAAGC
........................................................................................< <<<<<<...............................>>>>>> >..............................................................
Z11682.1 0.00 .AACTCTCGTAAACCAAGGAATGACAATGACGCGTGCCACAAGGATAGCAAGGCGCGCATTCCCCACGCTTTCCGATAGGATCAAGCGTGGAGTATACATGGACCTGCTTGTCTCGGGGGCAAGCCCAGGCAATGCATGGTCCCATGCGTGTGAAGAAGCACGCAAAGCAGCAGGGGAAATCAATCCCTGCACATCT GGAAGCCGCGGCCACGCCGAGUAGGAACGAGGGUACAGCUUCCTTCT
.................................................................................................................................................................................................... <<<<<<...............................>>>>>> ....
Z33883.1 0.00 .CAATGTTGAGTGGGGAAGTGGTGAACAATCAACAAGCCAGCACATCCAGGAAATTTCCTCAGATGATGTTGGCGCAGGAGCACACTATTCGTGTGTATGTGAGCGCAAACAACAGTCGCTCAATCAA GGGAGCCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGCUCCCATTCTTTTCTGTTTCTGTTTAGATGATTTAATCAACATTTAAAATTGATTTAATCAGAAGC
............................................................................................................................... <<<<<<...............................>>>>>> .............................................................