Seq ID Score (bits) Sequence
AB005257.1 0.00 .AAAUCGCGCUUUCCCCACGCCAAAUCACAGAUCUAGGCGUGAACAACCAAAUGACCUGCUGACCCCCAGCGAUUGCCUGGCGACAGCACGGUCGCAUGCAUGUGAUGAAACAUGCCAAUUUUCA GGAAGCCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGCUUCCUUUCUUUUCUGUCUCUGUUUAGAUUAUUUUAAUCACCAUUUAAAAUUGAUUUAAUCAGAAGC
............................................................................................................................ ..<<<.<...<<<...<<.....>>......>>>...>>>>.. ..............................................................
AB033998.1 0.00 .UUUGAUAGUGUGGAUCAUCUCGAACGCGAAAGAGAAGACCUAAUGAGGAGGCUCAGAGAUCUAGACCUCCGGCGCUUUCAGAUCUAAGCGCCACCACACUGGGUAACUGACUACAGUUGAGAAGGGGUGGACCGUAAACCACUGGUUGGCUGACUACAGCAACUGA CUUUCCCGAGGCCACGGCGAGUAGCAUCGAGGGUACAGGAAAGCUGGGACCAUUGCAUAGUCAACUAAUUUGGCUGU
...................................................................................................................................................................... ......<...<<<...<<.....>>......>>>...>..... ..................................
AB046864.1 0.00 .GAGAAGAUCUUAUGAGGAGGUUAAGAGACCUAGACCUCCGGCGCUUUCAGAUCUAAGCGCCCCACACUGGUUAACUGACUACAGUUGAGAAGGGGUGGACCGUAAACCACUGGCUGGCUGACUACAGCAACUGA CUUUCCCGAGGCCACGGCGAGUAGCAUCGAGGGUACAGGAAUGUUGGGACCAUUGUGUGAUCAACUAAUUUGGUUGCACUAGGGGAACCAAUGGGGUGGUAGGUCAAUC
...................................................................................................................................... ......<...<<<...<<.....>>......>>>...>..... ..................................................................
AF056197.1 0.00 .UCACUACGGGGGUUACCCCUAGUGUAGCAUGGGCCGAGGCGUGCAGGCAAGCACGCAAAGCAAGCAGGAAAGUGAAUCGAAGCUCCCUGCCUGCUCCCACUCUU GAGAGCCGAGGCCACGCCGAGUAGGAUCGAGGGUACAGCUCUCCUCCUUUUCUGUCUCUGUUUAGAUUAUUUUAAUCAACAUUU
........................................................................................................ ..<<<.<...<<<...<<.....>>......>>>...>>>>.. .........................................
AF111995.1 0.00 .AUCGUAGAAGUUCAAUAGUAAGAGUUAAGGAAGAUAGGCAUGUAGCUUAGCACCUACAUGUCUAUCGCCAGGGAAAUGUCUAAUCUGUCUACUUAGUAGCCUGGAAACGAACGGUAGGCCCUUAGAUUUUAACUUAGUUUAAUUUUUAGUUUAGUUUAAGUUAGUUUAGAGUAGGUAUAAAGAUGC CAGUGCCGGGGCCACGCGGCGUACGAUCGUGGGUACAGCACUAGGACGCCCACUAGG
.......................................................................................................................................................................................... ..<<<.<...<<<...<<.....>>......>>>...>>>>.. ..............
AF111997.1 0.00 .AUCUUAGAAGAUCAUUAGUUAGAGUUAAGGAAGAUAGGCAUGUAGCUUAGCACCUACAUGUCUAUCGCCAGGGAAAUGUCUAAUCUGUCUACUUAGUAGCCUGGAAACGAACGGUAGACCCUUAGAUUUUAAUUUAGUUUAAUUUUUAGUUUAGUUUAAGUUAGUUUAGAGUAGGUAUAAAGAUGC CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACAAGGACGCCCAUUAGG
.......................................................................................................................................................................................... ..<<<.<...<<<...<<.....>>......>>>...>>>>.. ..............
AF203002.1 0.00 .UUAGUAGCCUGGAAACGAACGGUAGACCCUUAGAUUUUAAUUUAGUUUAUUUUUUAGUUUAGUUUAAGUUAGUUUAGAGUAGGUAUAAAGAUGC CAGUGCCGAGGCCACGCGGAGUACGAUCGAGGGUACAGCACUAGGACGCCCACUAGGGGAAGAGCUAAAUUUUAGUUUAAGUUAAGUUUAAUUGGCUAAGUAUAGUUAAAAUUUAUAGGCUAGUAUAGAGUUAGAGC
.............................................................................................. ..<<<.<...<<<...<<.....>>......>>>...>>>>.. ..............................................................................................
AF260508.1 0.00 .UGCAGCAUGGUCCCAUGCGUGCGAACAAGCACGCAGAGCAGGUGACAAUCAUGACCUGCAACUAUCU GGAAGCCGCGACCACGCCGAGUAGGAUCGAGGGUACAGCUUCCUAUCCUUCUUUUCUGUCUCUGUUUAGAUUAUUUUAAUCACCAUUUAAAAUUGAUUUAAUCAGAUGC
................................................................... ..<<<.<...<<<...<<.....>>......>>>...>>>>.. ..................................................................
AJ278335.1 0.00 .UAGUAGCCUGGAAACGAACGGUAGACCCUUAGAUUUUAAUUUAGUUUAAUUUUUAGUUUAGUUUAAGUUAGUUUAGAGUAGGUAUAAAGAAGC CAGUGCCAGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUAGGACGCCCACUAGGGGAAGAGCUAAAUUUUAGUUUAAGUUAAGUUUAAUUGGCUAGGUAUAGUUAAAAUUUAUAGGCUAGUAUAGAGUUAGAGCAAAAAAAAAA
............................................................................................. ..<<<.<...<<<...<<.....>>......>>>...>>>>.. ........................................................................................................
AJ278336.1 0.00 .UAAUUUAGUUUAAUUUUUAGUUUAGUUUAAGUUAGUUUAGAGUAGGUAUAAAGAAGC CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUAGGACGCCCACUAGGGGAAGAGCUAAAUUUUAGUUUAAGUUAAGUUUAAUUGGCUAAGUAUAGUUAAAAUUUAUAGGCUAGUAUAGAGUUAGAGCAAAAAAAAAA
......................................................... ..<<<.<...<<<...<<.....>>......>>>...>>>>.. ........................................................................................................
AY044186.1 0.00 .GUAAAAUUCAAUAGUAAGAGUUAAGGAAGAUAGGCAUGUAGCUUGAUUACCUACAUGUCUAUCGCCAGGGAAAUGUCUAAUUUGUCUACUUAGUAGCCUGGAAACGAACGGUAGACCCUUAGAUUUUAAUUUAGUUUAAUUUUUAGUUUAGUUUAAGUUAGUUUAGAGUAGGUAUAAAGAUGC CAGUGCCGGGGCCACGCUGAGUACGACCGAGGGUACAGCACUAGGACGCCC
....................................................................................................................................................................................... ..<<<.<...<<<...<.......>......>>>...>>>>.. ........
L06252.1 0.00 .AGUUUAGAGUAGGUAUAAAGAUGC CAGUGCCAGGGCCACGCGGAGUACGAUCGAGGGUACAGCACCAGGACGCCCAUUAGGGGAAGAGCUAAAUUUUAGUUUAAGUUAAGUUUAAUUGGCUAAGUAUAGUUAAAAUUUAUAGGCUAGUAUAGAGUUAGAGC
........................ ..<<<.<...<<<...<<.....>>......>>>...>>>>.. ..............................................................................................
M28566.1 0.00 .UUGAGUAAAAUUCAAUAGUAAGAGUUAAGGAAGAUAGGCAUGUAGCUUGAUUACCUACAUGUCUAUCGCCAGGGAAAUGUCUAAUCUGUCUACUUAGUAGCCUGGAAACGAACGGUAGACCCUUAGAUUUUAAUUUAGUUUAAUUUUUAGUUUAGUUUAAGUUAGUUUAGAGUAGGUAUAAAGAUGC CAGUGCCGGGGCCACGCGGAGUACGACCGAGGGUACAGCACUAGGACGCCCAUUAG
........................................................................................................................................................................................... ..<<<.<...<<<...<<.....>>......>>>...>>>>.. .............
U15136.1 0.00 .GAUAAUCAUGACCUACAAACUUCAG GA-AGCCGCGCCCACGCCGAGUAGGAUCGAGGGUACAG---UC
......................... ....<.<....<<...<<.....>>......>>....>...>.
U52594.1 0.00 .AACGAACAGUAGACCCUUAGAUUUUAAUUUAGUUUAAUUUUUAGUUUAGUUUAAGUUAGUUUAGAGUAGGUUUAAAGAUGC CAGUGCCGGGGCCACGCGGAGUACGAUCGAGGGUACAGCACUUGGACGCCCAUUAUGGGAAGAGCUAAAUUUUAGUUUAAGUUAAGUUUAAUUGGCUAAGUAUAGUUAAAAUUUUUAGGCUAGUAUAGAGUUAGAGC
................................................................................. ..<<<.<...<<<...<<.....>>......>>>...>>>>.. ..............................................................................................
U52600.1 0.00 .GUCUACUGAGUAGCCUGGAAAUGAAAGGUAGACCCUUAGAUUCUAAUUUAGUUUAUUUUAGUUUAUUUUAAGUUAGUUUAGAGUAGUUAGAAAGAAGC CAGUGCCGAGGCCACUCGGAGUACGAUCGAGGGUACAGCACUAGGACGCCCACUAGGGGAAGAGCUAAAUGUAGUUUAAUUUUAAGUUAAGUAAAUUAGUAUAGUUAGUUUCAUUAGGCUAGUAUAGAGUUAGAGC
.................................................................................................. ..<<<.<...<<<...<<.....>>......>>>...>>>>.. .............................................................................................
X96871.1 0.00 .CUUGGCGGUUCAUCUUGGACCGCUGGAGUACGCGAGGCUUUUCCGCCCAUUUGUGGAAGUUGGGUACUGCGUGCGUGCCUUCGGGGACGCGCGCAGAGCUUGGCUCCGCAAUUUUGACUUGUGAGUUGUUCCCUACCAGAUACCCCAGAUUUACCCGUUACCCUAAAAUUCCCUCCCCUUCCUCUUC ACUCGCCGAGGCCACGCCGAGUAGGACCGAGGGUACAGCGAGUCUUUUAGCUUAAG
........................................................................................................................................................................................... ..<<<.<...<<<...<<.....>>......>>>...>>>>.. .............
Y08629.1 0.00 .GGAGCGCGCAACAAGGAUCACCAAACGUGCGUUCCCCACUAGCGCUGAUAAAACAAAGCGCAGUGUAUACAUGGACCUGCUUGCAUCUGGUCUUUCACCAGGCAAUGCAUGGUCACAUGCGUGCGAAGAGGCACGCAUCAUGGGCACUAAUCAAAUGCCUAAUGUUUCU GGAGACCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGUCUCCAUUUCUUUUCUGUCUCUGUUUAGAUUAUUUU
......................................................................................................................................................................... ..<<<.<...<<<...<<.....>>......>>>...>>>>.. ...............................
Y15936.2 0.00 .GAGUCAGAUAUUUCAUCUCUUUUUGCACCAGAUGAAGUGGACUGGAAAUUUAAAAUUGAGGCCUCCUCGUCAAGGCAUCUUGAGGAGGAACUCCAGUUUUGGAAAUCUAAAGCAACACAGCUGAUGCUUGAGAAAAAU UGAUGCCGAGGCCACGCCGGGUAGGAUCGAGGGUACAGCAUCGGUGCACUAACUUAGUUAGCGCACCACUAAUCAAAAGGAAAAAUUUUUAAGGGUUUUUUUUUC
.......................................................................................................................................... ..<<<.<...<<<...<<.....>>......>>>...>>>>.. ..............................................................
Y15937.2 0.00 .ACGCCCUUACAGCAAAUCUAUGAGGGCGUACGCGGCCUUCGUGGCCACGCAGAAGCGGUUGCCGUUGUAAAAUCACUU CAAUCCCGAGGCCACGCCGAGUAGGAUCGAGGGUACAGGAUUGUUUGAUUUUUUAAUCAAUUAAUUCAGAUUUAUUAAUUGGC
.............................................................................. ......<...<<<...<<.....>>......>>>...>..... ........................................
Y15938.2 0.00 .ACAGCCUGAUUGCGGGUUGCGGCCCCAGCAGUGCUUGGUCCGAAGCGUGCAAAGCUGCACGUAAGGUUUCCUUUAAGGAACCCAUUUCU GAAAGCCGAGGCCACGCCGAGUAGGAACGAGGGUACAGCUUUCAAUUUCUUUUCUGUCUCUUUUUAGAUUAGUCUAAUUAGCAUUAGAAUUGAUUUAAUUAGAAGC
......................................................................................... ..<<<.<...<<<...<<.....>>......>>>...>>>>.. ...............................................................
Z11682.1 0.00 .AACUCUCGUAAACCAAGGAAUGACAAUGACGCGUGCCACAAGGAUAGCAAGGCGCGCAUUCCCCACGCUUUCCGAUAGGAUCAAGCGUGGAGUAUACAUGGACCUGCUUGUCUCGGGGGCAAGCCCAGGCAAUGCAUGGUCCCAUGCGUGUGAAGAAGCACGCAAAGCAGCAGGGGAAAUCAAUCCCUGCACAUCU GGAAGCCGCGGCCACGCCGAGUAGGAACGAGGGUACAGCUUCCUUCU
.................................................................................................................................................................................................... ..<<<.<...<<<...<<.....>>......>>>...>>>>.. ....
Z33883.1 0.00 .CAAUGUUGAGUGGGGAAGUGGUGAACAAUCAACAAGCCAGCACAUCCAGGAAAUUUCCUCAGAUGAUGUUGGCGCAGGAGCACACUAUUCGUGUGUAUGUGAGCGCAAACAACAGUCGCUCAAUCAA GGGAGCCGCGGCCACGCCGAGUAGGAUCGAGGGUACAGCUCCCAUUCUUUUCUGUUUCUGUUUAGAUGAUUUAAUCAACAUUUAAAAUUGAUUUAAUCAGAAGC
............................................................................................................................... ..<<<.<...<<<...<<.....>>......>>>...>>>>.. .............................................................