Seq ID Score (bits) Sequence
AC018755.3 0.00 .CCUGAUGAGGAAGGGGCUGAGGGCCUGGACUCCUGGGUUCCUUGGGGAGGAGGGGCCGGGGGCCCGGACUCCUGGGUCC UGGCACCCACCC.GUAGAACCGACCUU.GCGGGGCCUUC....-GCCGCACACAAGCUCGUGUCUGUGGGUCCGUGUCGGGGGCUCACCAUCGCGGCUGGGGCCUCCCCGGCCCUCCCCCUCAUCCCUGGUCCUCCUGGUCCCUGUCUGUCUGUCUGUCGGGUCUGUCCACCUGCCGCGCCCCCCGGGCUGAGGUAGGAGG
..........................<............................<....................... ...<.....<<...<<<<..<<<.<<<.<.<...................>.>>>>.>>>..>>>>..>>...>.....> .<................<............>....>.......>............................................................................
AC095014.1 0.00 .UUUCACUUUUUUUUUUUGCAGCCGCGAUUGCCUAGCGGACUUCAUUUCGCCCCAGCGACUGUUCCUCAUCAGUUUGCU CCACGUCUACCCuGUAGAUCCGAAUUU.GUUUUAUACUAg...CUUUAAGGACAAAUUCGGUUCUAGAGAGGUUUGUGUGGUUCAAUAUCCAUCGAAAAAGUGUUGCUGAUGGCAAGCGGAAAAGUGAUUUUAUAAAUAAGUUUUAAGGUCAGAAAUGCUGAUGUCAACAAAUUCGUGCAUAUGUAUUACUCUCUUGAUAAG
...............................<..........................<................... ...<<....<<...<<<<..<<<.<<<.<<<...................>>>>>>.>>>..>>>>..>..>..>>.... >..<................<............>....>.......>...........................................................................
AC122451.3 0.00 .CAGAGCAAAUGCUACGUUAGUAAAAGGUCCCUGUGAGACGAUGCCCAU UGACAUAAACCC.GUAGAUCCGAUCUU.GUGGUGAAGUG....--GACCGCGCAAGCUCGUUUCUAUGGGUCUGUGGCAGUGUGGUGAUCUGACAAAGCACUAUGUAAGUGUUGCUCACUCACAUCUCAAUACACUCCUGCUCACACUCCAGUCCUCUACACAACCUCGGAACAAUAGCAUUUCCAUUGUUCUUCAUGGAUCUUUUAAUCCUCUCAUGUCUUACAAGGCAAG
..............................<................. ...<<....<<...<<<<..<<<.<<<.<<<...................>>>>>>.>>>..>>>>..>>..>>.....> ..<................<............>....>..................................................................................................................
AF480538.1 0.00 .CCUGU UGCCACAAACCC.GUAGAUCCGAACUU.GUGGUAUUA--....--GUCCGCACAAGCUUGUAUCUAUAGGUAUGUGUCUGUUAGG
..... ...<<....<<...<<<<..<<<.<<<.<<<...................>>>>>>.>>>..>>>>..>>..>>...... .....
AF480571.1 0.00 .CCCAU UGGCAUAAACCC.GUAGAUCCGAUCUU.GUGGUGAAGUG....--GACCGCACAAGCUCGCUUCUAUGGGUCUGUGUCAGUGUG
..... ...<<....<<...<<<<..<<<.<<<.<<<...................>>>>>>.>>>..>>>>..>>..>>...... ....
AL645782.2 0.00 .UGCUGAUAUCCUUGGAGGCAGACUGUUCCAGGUGCAACAACUUGACAAUGGGAAGGCGCUGUCAAGGUGAGCUGGCUUUCUCAAUACCUGUCAAGAAGAAACCUGUCAU CUAUAUAUACCCuGUAGAUCCGGAUUU.GUGUAAACAGAc...GCACAGUCACAAAUUCGUAUCUAGGGGAGUAUGUAGUUGAUGUAUAGGCUACAUUCAACUUCAACGGGCAAAGAUGACGACAUUUUAACAUUUGGUUUGUUAUUGUAAUUAAUACCACGACUGAACGU
.........................................................<............................<...................... ...<<....<<...<<<<..<<<.<<<.<<<...................>>>>>>.>>>..>>>>..>..>..>>.... .>...................<........>............>...............................................
AL645798.2 0.00 .AAAGAAACCCAUGUUUUUUUUUUCUGCAAGGCUGGCCUGAUACAAUAACUUAACAAAUACCAAUGAUGUCUGUCAU CUAUAUAUACCCuGUAGAUCCGAAUUU.GUGUGAAUAU-....--ACAGUCGCAAAUUCGUGUCUUGGGGAAUAUGUAGUUGACAUAAACACAACGCAAUACAGUGGAAUUGUGGACAUAUUGAUUAUUUUUGUUGCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAU
................................<..........................<................ ...<<.....<....<<<..<<<.<<<.<<<...................>>>>>>.>>>..>>>...>.....>>.... .>..<................<............>...>.......>.............................................................................
U77364.1 0.00 .UGGCAGCUGCCUGAAUGUCUGCUCUGGGUAGGACCCGAGGUUGUAACGUUGU CUAUAUAUACCCuGUAGAACCGAAUUU.GUGUGGUACCC....ACAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCAUAUAUCUCCGACAUGGCCAGAGACUGAGGCGCGGAGAGUACUGGCAGCCCAGCCGGCAAGCCACCUCUUUCUUUUUCAUUACCUUAGACUCCAGGAUGAUCGACUUUGCCUGGUGAAAUUGUACAGCCUUUU
.....<...........................<.................. ...<<.....<...<<<<..<<<.<<<.<<<...................>>>>>>.>>>..>>>>..>.....>>.... .>...........................................>......................................................................................................
U92575.1 0.00 .AUUCCAGUGUGGCUGCCGCGGGGAGUUUAUGGUGGCAAUAAUAUCCAUCGACGGUGUAAACGCGUCCCUCCAGAGAGCCACUGUCUU CUAUAUCUACCCuGUAGAUCCGGAUUU.GUGUAAAAAUCauuaAAGCAAUCACAAAUUCGCUUCUAGGGGAGUAUAUAGUGGAUUUAUACACGACGGCAACGAUGGAACCAAGGUAGAAGGGAAUUAUUUUUAAUUUACUCUACGUCACACCUUUAUUUGUUGUAGUUUUUGUUAUAAAUUUAUUAAUGGUAG
.........................................<............................<................ ...<<....<<...<<<<..<<<.<<<.<<<...................>>>>>>.>>>..>>>>..>..>..>>.... .>..<...............<............>....>.......>..................................................................
Z36753.1 0.00 .GAAAAUCCCCUCGUCCCGCCGUCCAGAAGGUCGUUAAAUUUACGACCGUCCCUUUCUCCCACAACCCCCCUUCGUCCGUCCGCCCUCCCGGACAUUUGAUGUUACCCUCUAUUCUGAACUUCUUCUUUUAUUCUGGGAAUAUUCUGUUCAUGAUGAUAUUCAAAAAGGUAUGUGAACUCAUCGACAU GCUCGUCUACCCuGUAGAUCGAGCUGU.GUGUUUGAAAC....AAUCAUACACGAGCUAGACUACAAGGUGCACGAACAAACCGAAGAUUUAU
....................<............................<..........................<<.........<<<<..<...<<.<...................>.>>...>....>>>>........>>.....>..<...............<............>... .>.......>...................................................................... .............
Z68760.2 0.00 .AAGGGGACGGACGAACGUCCGCGCACACUAAUACACCCUUCACCCUAUCUUCAAUGGUGGCACUCAUGGUGUACUCGGUUGUGUGCGGGCCUUUCAUUCUUAUACUCCCAGGUUCGACACCACCGGUGCACUUUUGUGUCACCAACAUUUGCCUGCUCACUUGUCCGAAAA GUCCGUCUACCC.GUAGCUCCUAUCCAuGUUACUGGUCA....AAAAGUGAACAUGGAAGCAGGUACAGGUGCACGGCGAGUAGGGUCAUGAAGCUGGGGCUCUGGGAG
....<............................<........................<<....<....<<....<<<.<.<<.<.....................>.>>.>.>>>....>>.....>..>>.....>..<................<............. >....>........>................................................................. .............................