Seq ID Score (bits) Sequence
AC018755.3 1.00 .CCUGAUGAGGAAGGGGCUGAGGGCCUGGACUCCUGGGUUCCUUGGGGAGGAGGGGCCGGGGGCCCGGACUCCUGGGUCC UGGCACCCACCC.GUAGAACCGACCUU.GCGGGGCCUUC....-GCCGCACACAAGCUCGUGUCUGUGGGUCCGUGUCGGGGGCUCACCAUCGCGGCUGGGGCCUCCCCGGCCCUCCCCCUCAUCCCUGGUCCUCCUGGUCCCUGUCUGUCUGUCUGUCGGGUCUGUCCACCUGCCGCGCCCCCCGGGCUGAGGUAGGAGG
............................................................................... ................................................................................ .........................................................................................................................
AC095014.1 1.00 .UUUCACUUUUUUUUUUUGCAGCCGCGAUUGCCUAGCGGACUUCAUUUCGCCCCAGCGACUGUUCCUCAUCAGUUUGCU CCACGUCUACCCuGUAGAUCCGAAUUU.GUUUUAUACUAg...CUUUAAGGACAAAUUCGGUUCUAGAGAGGUUUGUGUGGUUCAAUAUCCAUCGAAAAAGUGUUGCUGAUGGCAAGCGGAAAAGUGAUUUUAUAAAUAAGUUUUAAGGUCAGAAAUGCUGAUGUCAACAAAUUCGUGCAUAUGUAUUACUCUCUUGAUAAG
.............................................................................. ..............<<<<.<<<<<<<<.<<<<<...............>>>>>>>>>>>>>.>>>>.............. ..........................................................................................................................
AC122451.3 1.00 .CAGAGCAAAUGCUACGUUAGUAAAAGGUCCCUGUGAGACGAUGCCCAU UGACAUAAACCC.GUAGAUCCGAUCUU.GUGGUGAAGUG....--GACCGCGCAAGCUCGUUUCUAUGGGUCUGUGGCAGUGUGGUGAUCUGACAAAGCACUAUGUAAGUGUUGCUCACUCACAUCUCAAUACACUCCUGCUCACACUCCAGUCCUCUACACAACCUCGGAACAAUAGCAUUUCCAUUGUUCUUCAUGGAUCUUUUAAUCCUCUCAUGUCUUACAAGGCAAG
................................................ ................................................................................ ........................................................................................................................................................
AF480538.1 1.00 .CCUGU UGCCACAAACCC.GUAGAUCCGAACUU.GUGGUAUUA--....--GUCCGCACAAGCUUGUAUCUAUAGGUAUGUGUCUGUUAGG
..... ................................................................................ .....
AF480571.1 1.00 .CCCAU UGGCAUAAACCC.GUAGAUCCGAUCUU.GUGGUGAAGUG....--GACCGCACAAGCUCGCUUCUAUGGGUCUGUGUCAGUGUG
..... ................................................................................ ....
AL645782.2 1.00 .UGCUGAUAUCCUUGGAGGCAGACUGUUCCAGGUGCAACAACUUGACAAUGGGAAGGCGCUGUCAAGGUGAGCUGGCUUUCUCAAUACCUGUCAAGAAGAAACCUGUCAU CUAUAUAUACCCuGUAGAUCCGGAUUU.GUGUAAACAGAc...GCACAGUCACAAAUUCGUAUCUAGGGGAGUAUGUAGUUGAUGUAUAGGCUACAUUCAACUUCAACGGGCAAAGAUGACGACAUUUUAACAUUUGGUUUGUUAUUGUAAUUAAUACCACGACUGAACGU
............................................................................................................. ..........<<<.<<<<<.<<<<<<<.<<<...................>>>>>>>>>>.>>>>>.>>>.......... ...........................................................................................
AL645798.2 1.00 .AAAGAAACCCAUGUUUUUUUUUUCUGCAAGGCUGGCCUGAUACAAUAACUUAACAAAUACCAAUGAUGUCUGUCAU CUAUAUAUACCCuGUAGAUCCGAAUUU.GUGUGAAUAU-....--ACAGUCGCAAAUUCGUGUCUUGGGGAAUAUGUAGUUGACAUAAACACAACGCAAUACAGUGGAAUUGUGGACAUAUUGAUUAUUUUUGUUGCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAU
............................................................................ ..........<<<<.<<<<.<<<<<<<.<<<...................>>>>>>>>>>.>>>>>>>>........... ............................................................................................................................
U77364.1 1.00 .UGGCAGCUGCCUGAAUGUCUGCUCUGGGUAGGACCCGAGGUUGUAACGUUGU CUAUAUAUACCCuGUAGAACCGAAUUU.GUGUGGUACCC....ACAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCAUAUAUCUCCGACAUGGCCAGAGACUGAGGCGCGGAGAGUACUGGCAGCCCAGCCGGCAAGCCACCUCUUUCUUUUUCAUUACCUUAGACUCCAGGAUGAUCGACUUUGCCUGGUGAAAUUGUACAGCCUUUU
.................................................... ..........<<<.<<<<<.<<<<<<<.<<<...................>>>>>>>>>>.>>>>>.>>>.......... ....................................................................................................................................................
U92575.1 1.00 .AUUCCAGUGUGGCUGCCGCGGGGAGUUUAUGGUGGCAAUAAUAUCCAUCGACGGUGUAAACGCGUCCCUCCAGAGAGCCACUGUCUU CUAUAUCUACCCuGUAGAUCCGGAUUU.GUGUAAAAAUCauuaAAGCAAUCACAAAUUCGCUUCUAGGGGAGUAUAUAGUGGAUUUAUACACGACGGCAACGAUGGAACCAAGGUAGAAGGGAAUUAUUUUUAAUUUACUCUACGUCACACCUUUAUUUGUUGUAGUUUUUGUUAUAAAUUUAUUAAUGGUAG
....................................................................................... ....................<<<<<<<.<<<...................>>>>>>>>>>.................... .................................................................................................................
Z36753.1 1.00 .GAAAAUCCCCUCGUCCCGCCGUCCAGAAGGUCGUUAAAUUUACGACCGUCCCUUUCUCCCACAACCCCCCUUCGUCCGUCCGCCCUCCCGGACAUUUGAUGUUACCCUCUAUUCUGAACUUCUUCUUUUAUUCUGGGAAUAUUCUGUUCAUGAUGAUAUUCAAAAAGGUAUGUGAACUCAUCGACAU GCUCGUCUACCCuGUAGAUCGAGCUGU.GUGUUUGAAAC....AAUCAUACACGAGCUAGACUACAAGGUGCACGAACAAACCGAAGAUUUAU
........................................................................................................................................................................................... ................................................................................ .............
Z68760.2 1.00 .AAGGGGACGGACGAACGUCCGCGCACACUAAUACACCCUUCACCCUAUCUUCAAUGGUGGCACUCAUGGUGUACUCGGUUGUGUGCGGGCCUUUCAUUCUUAUACUCCCAGGUUCGACACCACCGGUGCACUUUUGUGUCACCAACAUUUGCCUGCUCACUUGUCCGAAAA GUCCGUCUACCC.GUAGCUCCUAUCCAuGUUACUGGUCA....AAAAGUGAACAUGGAAGCAGGUACAGGUGCACGGCGAGUAGGGUCAUGAAGCUGGGGCUCUGGGAG
........................................................................................................................................................................... ................................................................................ .............................