Seq ID Score (bits) Sequence
AC018755.3 0.00 .CCUGAUGAGGAAGGGGCUGAGGGCCUGGACUCCUGGGUUCCUUGGGGAGGAGGGGCCGGGGGCCCGGACUCCUGGGUCC UGGCACCCACCC.GUAGAACCGACCUU.GCGGGGCCUUC....-GCCGCACACAAGCUCGUGUCUGUGGGUCCGUGUCGGGGGCUCACCAUCGCGGCUGGGGCCUCCCCGGCCCUCCCCCUCAUCCCUGGUCCUCCUGGUCCCUGUCUGUCUGUCUGUCGGGUCUGUCCACCUGCCGCGCCCCCCGGGCUGAGGUAGGAGG
............................................................................... ..............<<<<..<<<.<<<.<.<...................>.>>>>.>>>..>>>>.............. .........................................................................................................................
AC095014.1 0.00 .UUUCACUUUUUUUUUUUGCAGCCGCGAUUGCCUAGCGGACUUCAUUUCGCCCCAGCGACUGUUCCUCAUCAGUUUGCU CCACGUCUACCCuGUAGAUCCGAAUUU.GUUUUAUACUAg...CUUUAAGGACAAAUUCGGUUCUAGAGAGGUUUGUGUGGUUCAAUAUCCAUCGAAAAAGUGUUGCUGAUGGCAAGCGGAAAAGUGAUUUUAUAAAUAAGUUUUAAGGUCAGAAAUGCUGAUGUCAACAAAUUCGUGCAUAUGUAUUACUCUCUUGAUAAG
.............................................................................. ..............<<<<..<<<.<<<.<<<...................>>>>>>.>>>..>>>>.............. ..........................................................................................................................
AC122451.3 0.00 .CAGAGCAAAUGCUACGUUAGUAAAAGGUCCCUGUGAGACGAUGCCCAU UGACAUAAACCC.GUAGAUCCGAUCUU.GUGGUGAAGUG....--GACCGCGCAAGCUCGUUUCUAUGGGUCUGUGGCAGUGUGGUGAUCUGACAAAGCACUAUGUAAGUGUUGCUCACUCACAUCUCAAUACACUCCUGCUCACACUCCAGUCCUCUACACAACCUCGGAACAAUAGCAUUUCCAUUGUUCUUCAUGGAUCUUUUAAUCCUCUCAUGUCUUACAAGGCAAG
................................................ ..............<<<<..<<<.<<<.<<<...................>>>>>>.>>>..>>>>.............. ........................................................................................................................................................
AF480538.1 0.00 .CCUGU UGCCACAAACCC.GUAGAUCCGAACUU.GUGGUAUUA--....--GUCCGCACAAGCUUGUAUCUAUAGGUAUGUGUCUGUUAGG
..... ..............<<<<..<<<.<<<.<<<...................>>>>>>.>>>..>>>>.............. .....
AF480571.1 0.00 .CCCAU UGGCAUAAACCC.GUAGAUCCGAUCUU.GUGGUGAAGUG....--GACCGCACAAGCUCGCUUCUAUGGGUCUGUGUCAGUGUG
..... ..............<<<<..<<<.<<<.<<<...................>>>>>>.>>>..>>>>.............. ....
AL645782.2 0.00 .UGCUGAUAUCCUUGGAGGCAGACUGUUCCAGGUGCAACAACUUGACAAUGGGAAGGCGCUGUCAAGGUGAGCUGGCUUUCUCAAUACCUGUCAAGAAGAAACCUGUCAU CUAUAUAUACCCuGUAGAUCCGGAUUU.GUGUAAACAGAc...GCACAGUCACAAAUUCGUAUCUAGGGGAGUAUGUAGUUGAUGUAUAGGCUACAUUCAACUUCAACGGGCAAAGAUGACGACAUUUUAACAUUUGGUUUGUUAUUGUAAUUAAUACCACGACUGAACGU
............................................................................................................. ..............<<<<..<<<.<<<.<<<...................>>>>>>.>>>..>>>>.............. ...........................................................................................
AL645798.2 0.00 .AAAGAAACCCAUGUUUUUUUUUUCUGCAAGGCUGGCCUGAUACAAUAACUUAACAAAUACCAAUGAUGUCUGUCAU CUAUAUAUACCCuGUAGAUCCGAAUUU.GUGUGAAUAU-....--ACAGUCGCAAAUUCGUGUCUUGGGGAAUAUGUAGUUGACAUAAACACAACGCAAUACAGUGGAAUUGUGGACAUAUUGAUUAUUUUUGUUGCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAUCUAU
............................................................................ ...............<<<..<<<.<<<.<<<...................>>>>>>.>>>..>>>............... ............................................................................................................................
U77364.1 0.00 .UGGCAGCUGCCUGAAUGUCUGCUCUGGGUAGGACCCGAGGUUGUAACGUUGU CUAUAUAUACCCuGUAGAACCGAAUUU.GUGUGGUACCC....ACAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCAUAUAUCUCCGACAUGGCCAGAGACUGAGGCGCGGAGAGUACUGGCAGCCCAGCCGGCAAGCCACCUCUUUCUUUUUCAUUACCUUAGACUCCAGGAUGAUCGACUUUGCCUGGUGAAAUUGUACAGCCUUUU
.................................................... ..............<<<<..<<<.<<<.<<<...................>>>>>>.>>>..>>>>.............. ....................................................................................................................................................
U92575.1 0.00 .AUUCCAGUGUGGCUGCCGCGGGGAGUUUAUGGUGGCAAUAAUAUCCAUCGACGGUGUAAACGCGUCCCUCCAGAGAGCCACUGUCUU CUAUAUCUACCCuGUAGAUCCGGAUUU.GUGUAAAAAUCauuaAAGCAAUCACAAAUUCGCUUCUAGGGGAGUAUAUAGUGGAUUUAUACACGACGGCAACGAUGGAACCAAGGUAGAAGGGAAUUAUUUUUAAUUUACUCUACGUCACACCUUUAUUUGUUGUAGUUUUUGUUAUAAAUUUAUUAAUGGUAG
....................................................................................... ..............<<<<..<<<.<<<.<<<...................>>>>>>.>>>..>>>>.............. .................................................................................................................
Z36753.1 0.00 .GAAAAUCCCCUCGUCCCGCCGUCCAGAAGGUCGUUAAAUUUACGACCGUCCCUUUCUCCCACAACCCCCCUUCGUCCGUCCGCCCUCCCGGACAUUUGAUGUUACCCUCUAUUCUGAACUUCUUCUUUUAUUCUGGGAAUAUUCUGUUCAUGAUGAUAUUCAAAAAGGUAUGUGAACUCAUCGACAU GCUCGUCUACCCuGUAGAUCGAGCUGU.GUGUUUGAAAC....AAUCAUACACGAGCUAGACUACAAGGUGCACGAACAAACCGAAGAUUUAU
.......................................................................................<<<<..<...<<.<...................>.>>...>....>>>>................................................... ................................................................................ .............
Z68760.2 0.00 .AAGGGGACGGACGAACGUCCGCGCACACUAAUACACCCUUCACCCUAUCUUCAAUGGUGGCACUCAUGGUGUACUCGGUUGUGUGCGGGCCUUUCAUUCUUAUACUCCCAGGUUCGACACCACCGGUGCACUUUUGUGUCACCAACAUUUGCCUGCUCACUUGUCCGAAAA GUCCGUCUACCC.GUAGCUCCUAUCCAuGUUACUGGUCA....AAAAGUGAACAUGGAAGCAGGUACAGGUGCACGGCGAGUAGGGUCAUGAAGCUGGGGCUCUGGGAG
.....................................................................<<....<<<.<.<<.<.....................>.>>.>.>>>....>>................................................. ................................................................................ .............................