Seq ID Score (bits) Sequence
AC006590.11 0.00 .UGUGGACAACAAAGAAAGUGUUCUGAGCCAAACUAUUGUUAAAUAUCAUUACGAAUGCCAAAGUAUGUAAAUGCAACCGGGCAUAUGUAAAUAUUGGCAUUGGUGACAUGUGCAAAUGUUUGUAUG GCUGAUUCCCUGAGACCCU..AACUUGUGACUUUU-AAUACCAGUUUCACAAGUUUUGAUCUCC-GGUA-UUGGACGCAAACUUGCUGAUGUUAGUAAAAAAUAAGGCAAAAACGAAUUCCCUUUCAAGGCACAAGUAUCGGCAAUUC
.............................................................................................................................. ..<.<.<<...>><.<<.....<<<.<<<<................>>>>>.>>...........>>...>>.> ..<.....>.................................................................
AC018755.3 0.00 .GUUUUUGGUCUUUCUGUCUCUGGCUCUCAGAAUGUCUCUGUGCCUAUCUCCAUCUCUGACCCCCACCCCAGGGUCUACCGGGCCACCGCACACCAUGUUGCCAGUC UCUAGGUCCCUGAGACCCUuuAACCUGUGAGG----ACAUCCAGGGUCACAGGUGAGGUUCUU-GGGAGCCUGGCGUCUGGCCCAACCACACACCUGGGGAAUUGCUGGCCUGACUUCUGACCCCUGACUCCUCAUACCCUUCCUCCAGAGCAUGACAUUUGACCACC
.......................................................................................................... .<<<<.<<...>><.<<<....<<..<<<<................>>>>..>>..........>>>..>>>>> .<..........>.................................................................................
AC122451.3 0.00 .CUCUAAUUCCCAAGCUGUCCGUUUACCUGGAAGAAGAAUUCUCCUGCAUCACACGAGACUUU GCCUAGUCCCUGAGACCCU..AACUUGUGAGGUAU-UUUAGUAACAUCACAAGUCAGGUUCUU-GGGACCUAGGCGGAGGGAUACCAGCAGCUUGGGACCUUAUUGAUUCUCGGCAUAAACCACCAGAACAAAAGAACAGGCAUAGAUUCUGCAUAGGCGCAAAGAACAAUGGUUUUCUUUCUAAUCAGCAAGGGUUUCACCAUGACAACAC
.............................................................. .<<<<.<<...>><.<<<....<<<.<<<<................>>>>>.>>..........>>>..>>>>> .<.........>..............................................................................................................................
AP000962.2 0.00 .UUAGUCUAUAAAUGGUCGUCGUGAUUACUCAGCUCAUCCUAACUUUUAUAUAUCAUAUAUAUUUCUACUGAAGUAUUUUAAAUAGUAUUUAGAGGUAAAAGUCUAAGUGAACCCAACUGUAAUUUCUAAGCUAUCCUUAUUUCUGGAAGAAGAAUUCUACCGCAUCAAACCAGACUUU UCCUAGUCCCUGAGACCCU..AACUUGUGAGGUAU-UUUAGUAACAUCACAAGUCAGGCUCUU-GGGACCUAGGCGGAGGGGAACCAGCAGCUUUG
.................................................................................................................................................................................. .<<<<.<<...>><.<<<....<<<.<<<<................>>>>>.>>..........>>>..>>>>> .<.........>..........
AP001359.4 0.00 .UAGAGAAGAAAUACCAUACCACCUGUUUGUUGCAUCUUAGUUAUGAACCUCGAACAGAAAUUGCCUGUCAUUCUUGUUUUGCUUUGCUUUGUCUCAAGAAAGAAAACAUUGUUGCGCUCC UCUCAGUCCCUGAGACCCU..AACUUGUGAUGUUUACCGUUUAAAUCCACGGGUUAGGCUCUU-GGGAGCUGCGAGUCGUGCUUUUGCAUCCUGGAAAUUUGGUGGAAUUUUAUUCUUUAAAGCAAAAACAAAAGAAAAGAAAGUUUGUCUGAG
........................................................................................................................ .<.<<.<<...>><.<<<....<<<.<<<..................>>>>.>>..........>>>..>>>.> .<........>.....................................................................
U01829.1 0.00 .CAUCCAUCCCGCCCCAAUCGCUCCCAGAGACUCACACCGGUCACUCUAACUAUUAGUCUUCCAUCCGGACCGCAACCGGUUCAUUCCAACUCCAUCCAUCCUAUUUCUAAACUACAGUAAUCCUUUAAAAAAUCCUAAAACUAGAAUUUUUGGUUGGUUUAUAUGUAUCAGAUGCUUUCG GCCUGUUCCCUGAGACCUC..AAG-UGUGAGCGUUCUGAACAUGCUUCACGCCU-GGGCUCUCCGGGUACCAGGACGGUCUGAGCAGACACGUU
.................................................................................................................................................................................... .<<<<.<<...>><.<<<....<<.<<<<<................>>>>>.>>..........>>>..>>>>> .<.....>............
U01830.1 0.00 .AAUAAAUCUUAUAGUUUUUAGAUUCUAGACAAUUUCUAGAGUUUUGGUUGGUUUAUGAGUUUAUGCUUCCG GCCUGUUCCCUGAGACCUC..AAG-UGUGAGUGUACUAUUGAUGCUUCACACCU-GGGCUCUCCGGGUACCAGGACGGUUUGAGCAGAUCUUUUUUUCUGUUUUCACGGGGUUUUUUUUCACACUGGGAGCUAGUUCCAAUAAAAUGGUAUUCGGGGAAAAGGGUCAAACGAUUAUUUUCAGAAGUCGAC
....................................................................... .<<<<.<<...>><.<<<....<<.<<<<<................>>>>>.>>..........>>>..>>>>> .<.....>............................................................................................................
U01837.1 0.00 .UCAAUCUACCAACUAUUUCCUGGGCUACAGUAACCCGAAGAGUUAUCAUAUUCAUCACAUUCUAGACUUUCUGAGAAAGACUUUUGGUUGGUUUAUAUGUUCUGAUGCUUUCG GCCUGCUCCCUGAGACCUC..AAG-UGUGAGCGCACUGUUGAUGCUUCACGCCU-GGGCUCUCUGGGUACCAGGACGGCUUGAGCAGACAUUUUUUGAUUCUGGUUUUGUAGUUUUUUAGGUUAAAACGUAGCUGAAACAAGUCAAAUCAUUGGUUUCAGA
................................................................................................................. .<<<<.<<...>><.<<<....<<.<<<<<................>>>>>.>>..........>>>..>>>>> .<.....>...............................................................................
U01838.1 0.00 .UCAGCAUGCGUCUUAACUAUUCCCUACAGUAAUCCUAUCCCAUUCCAUCCUAAGUUAUCUGGAAACAUGGUUUGGUUGGUUUGAUAUGAUACAGCUCACG GCCUGCUCCCUGAGACCUC..AAG-UGUGAGCGUACUGUAGAUGCUUCACACCU-GGGCUCUCUGGGUACCAGGACGGCGUAUUUGAGCAACACUUUUUUCAGUUUUUUAAAUUCAUGUGGAUUGGUUUAAGAUUUAGAAAUGUUUAGGUUUAACAGAGGGAGAAUUC
.................................................................................................... .<<<<.<<...>><.<<<....<<.<<<<<................>>>>>.>>..........>>>..>>>>> .<.........>..................................................................................