Seq ID Score (bits) Sequence
AC006590.11 1.00 .UGUGGACAACAAAGAAAGUGUUCUGAGCCAAACUAUUGUUAAAUAUCAUUACGAAUGCCAAAGUAUGUAAAUGCAACCGGGCAUAUGUAAAUAUUGGCAUUGGUGACAUGUGCAAAUGUUUGUAUG GCUGAUUCCCUGAGACCCU..AACUUGUGACUUUU-AAUACCAGUUUCACAAGUUUUGAUCUCC-GGUA-UUGGACGCAAACUUGCUGAUGUUAGUAAAAAAUAAGGCAAAAACGAAUUCCCUUUCAAGGCACAAGUAUCGGCAAUUC
.............................................................................................................................. .......................................................................... ..........................................................................
AC018755.3 1.00 .GUUUUUGGUCUUUCUGUCUCUGGCUCUCAGAAUGUCUCUGUGCCUAUCUCCAUCUCUGACCCCCACCCCAGGGUCUACCGGGCCACCGCACACCAUGUUGCCAGUC UCUAGGUCCCUGAGACCCUuuAACCUGUGAGG----ACAUCCAGGGUCACAGGUGAGGUUCUU-GGGAGCCUGGCGUCUGGCCCAACCACACACCUGGGGAAUUGCUGGCCUGACUUCUGACCCCUGACUCCUCAUACCCUUCCUCCAGAGCAUGACAUUUGACCACC
.......................................................................................................... .<<<<<<.<<<<<<<.<<<<..................................>>>>.>>>>.>>>.>>>>>> ..............................................................................................
AC122451.3 1.00 .CUCUAAUUCCCAAGCUGUCCGUUUACCUGGAAGAAGAAUUCUCCUGCAUCACACGAGACUUU GCCUAGUCCCUGAGACCCU..AACUUGUGAGGUAU-UUUAGUAACAUCACAAGUCAGGUUCUU-GGGACCUAGGCGGAGGGAUACCAGCAGCUUGGGACCUUAUUGAUUCUCGGCAUAAACCACCAGAACAAAAGAACAGGCAUAGAUUCUGCAUAGGCGCAAAGAACAAUGGUUUUCUUUCUAAUCAGCAAGGGUUUCACCAUGACAACAC
.............................................................. .......................................................................... ..........................................................................................................................................
AP000962.2 1.00 .UUAGUCUAUAAAUGGUCGUCGUGAUUACUCAGCUCAUCCUAACUUUUAUAUAUCAUAUAUAUUUCUACUGAAGUAUUUUAAAUAGUAUUUAGAGGUAAAAGUCUAAGUGAACCCAACUGUAAUUUCUAAGCUAUCCUUAUUUCUGGAAGAAGAAUUCUACCGCAUCAAACCAGACUUU UCCUAGUCCCUGAGACCCU..AACUUGUGAGGUAU-UUUAGUAACAUCACAAGUCAGGCUCUU-GGGACCUAGGCGGAGGGGAACCAGCAGCUUUG
.................................................................................................................................................................................. .<<<<<<<<<.<<<<.<<<...<<<<<......................>>>>>.>>>.>>>>.>>>>>.>>>> ......................
AP001359.4 1.00 .UAGAGAAGAAAUACCAUACCACCUGUUUGUUGCAUCUUAGUUAUGAACCUCGAACAGAAAUUGCCUGUCAUUCUUGUUUUGCUUUGCUUUGUCUCAAGAAAGAAAACAUUGUUGCGCUCC UCUCAGUCCCUGAGACCCU..AACUUGUGAUGUUUACCGUUUAAAUCCACGGGUUAGGCUCUU-GGGAGCUGCGAGUCGUGCUUUUGCAUCCUGGAAAUUUGGUGGAAUUUUAUUCUUUAAAGCAAAAACAAAAGAAAAGAAAGUUUGUCUGAG
.......................................................................................................................< <<.<<<<.<<<<<<<.<<<..<<<<<<......................>>>>>>>>>.>>>>.>>>.>>>>.> >>..............................................................................
U01829.1 1.00 .CAUCCAUCCCGCCCCAAUCGCUCCCAGAGACUCACACCGGUCACUCUAACUAUUAGUCUUCCAUCCGGACCGCAACCGGUUCAUUCCAACUCCAUCCAUCCUAUUUCUAAACUACAGUAAUCCUUUAAAAAAUCCUAAAACUAGAAUUUUUGGUUGGUUUAUAUGUAUCAGAUGCUUUCG GCCUGUUCCCUGAGACCUC..AAG-UGUGAGCGUUCUGAACAUGCUUCACGCCU-GGGCUCUCCGGGUACCAGGACGGUCUGAGCAGACACGUU
.................................................................................................................................................................<<<<<.<<<<<<<<<<.<< .........................>>.>>>>>.>>>>>>>>>>.............................. ....................
U01830.1 1.00 .AAUAAAUCUUAUAGUUUUUAGAUUCUAGACAAUUUCUAGAGUUUUGGUUGGUUUAUGAGUUUAUGCUUCCG GCCUGUUCCCUGAGACCUC..AAG-UGUGAGUGUACUAUUGAUGCUUCACACCU-GGGCUCUCCGGGUACCAGGACGGUUUGAGCAGAUCUUUUUUUCUGUUUUCACGGGGUUUUUUUUCACACUGGGAGCUAGUUCCAAUAAAAUGGUAUUCGGGGAAAAGGGUCAAACGAUUAUUUUCAGAAGUCGAC
....................................................................... .......................................................................... ....................................................................................................................
U01837.1 1.00 .UCAAUCUACCAACUAUUUCCUGGGCUACAGUAACCCGAAGAGUUAUCAUAUUCAUCACAUUCUAGACUUUCUGAGAAAGACUUUUGGUUGGUUUAUAUGUUCUGAUGCUUUCG GCCUGCUCCCUGAGACCUC..AAG-UGUGAGCGCACUGUUGAUGCUUCACGCCU-GGGCUCUCUGGGUACCAGGACGGCUUGAGCAGACAUUUUUUGAUUCUGGUUUUGUAGUUUUUUAGGUUAAAACGUAGCUGAAACAAGUCAAAUCAUUGGUUUCAGA
................................................................................................................. .......................................................................... .......................................................................................
U01838.1 1.00 .UCAGCAUGCGUCUUAACUAUUCCCUACAGUAAUCCUAUCCCAUUCCAUCCUAAGUUAUCUGGAAACAUGGUUUGGUUGGUUUGAUAUGAUACAGCUCACG GCCUGCUCCCUGAGACCUC..AAG-UGUGAGCGUACUGUAGAUGCUUCACACCU-GGGCUCUCUGGGUACCAGGACGGCGUAUUUGAGCAACACUUUUUUCAGUUUUUUAAAUUCAUGUGGAUUGGUUUAAGAUUUAGAAAUGUUUAGGUUUAACAGAGGGAGAAUUC
.................................................................................................... .......................................................................... ..............................................................................................