Seq ID Score (bits) Sequence
AC006590.11 0.00 .TGTGGACAACAAAGAAAGTGTTCTGAGCCAAACTATTGTTAAATATCATTACGAATGCCAAAGTATGTAAATGCAACCGGGCATATGTAAATATTGGCATTGGTGACATGTGCAAATGTTTGTATG GCUGAUUCCCUGAGACCCU..AACUUGUGACUUUU-AAUACCAGUUUCACAAGUUUUGAUCUCC-GGUA-UUGGACGCAAACTTGCTGATGTTAGTAAAAAATAAGGCAAAAACGAATTCCCTTTCAAGGCACAAGTATCGGCAATTC
.............................................................................................................................. .....................<<<<<<<<<................>>>>>>>>>................... ........<<<<<<<<<<<..........<<<<.............>>>>..........>>>>>>>>>>>...
AC018755.3 0.00 .GTTTTTGGTCTTTCTGTCTCTGGCTCTCAGAATGTCTCTGTGCCTATCTCCATCTCTGACCCCCACCCCAGGGTCTACCGGGCCACCGCACACCATGTTGCCAGTC UCUAGGUCCCUGAGACCCUuuAACCUGUGAGG----ACAUCCAGGGUCACAGGUGAGGUUCUU-GGGAGCCUGGCGTCTGGCCCAACCACACACCTGGGGAATTGCTGGCCTGACTTCTGACCCCTGACTCCTCATACCCTTCCTCCAGAGCATGACATTTGACCACC
.......................................................................................................... .<<<<<<<<<<<<<<.......<<<<<<<<................>>>>>>>>.....>>>>.>>>>>>>>>> ....................<<<<<<...........................................>>>>>>...................
AC122451.3 0.00 .CTCTAATTCCCAAGCTGTCCGTTTACCTGGAAGAAGAATTCTCCTGCATCACACGAGACTTT GCCUAGUCCCUGAGACCCU..AACUUGUGAGGUAU-UUUAGUAACAUCACAAGUCAGGUUCUU-GGGACCUAGGCGGAGGGATACCAGCAGCTTGGGACCTTATTGATTCTCGGCATAAACCACCAGAACAAAAGAACAGGCATAGATTCTGCATAGGCGCAAAGAACAATGGTTTTCTTTCTAATCAGCAAGGGTTTCACCATGACAACAC
..........................................................<<<< <<<<<<................<<<<<<<<................>>>>>>>>...............>>>>> >>>>>...................<<<<<<<<<<<........<<<<<<.<<<<<..................>>>>>..................>>>>>>.......>>>>>>>>>>>..................
AP000962.2 0.00 .TTAGTCTATAAATGGTCGTCGTGATTACTCAGCTCATCCTAACTTTTATATATCATATATATTTCTACTGAAGTATTTTAAATAGTATTTAGAGGTAAAAGTCTAAGTGAACCCAACTGTAATTTCTAAGCTATCCTTATTTCTGGAAGAAGAATTCTACCGCATCAAACCAGACTTT UCCUAGUCCCUGAGACCCU..AACUUGUGAGGUAU-UUUAGUAACAUCACAAGUCAGGCUCUU-GGGACCUAGGCGGAGGGGAACCAGCAGCTTTG
..............................................................................................................................................................................<<<< <<<<<<<<<<<<<<<.......<<<<<<<<................>>>>>>>>.....>>>>.>>>>>>>>>> ...>>>>>..............
AP001359.4 0.00 .TAGAGAAGAAATACCATACCACCTGTTTGTTGCATCTTAGTTATGAACCTCGAACAGAAATTGCCTGTCATTCTTGTTTTGCTTTGCTTTGTCTCAAGAAAGAAAACATTGTTGCGCTCC UCUCAGUCCCUGAGACCCU..AACUUGUGAUGUUUACCGUUUAAAUCCACGGGUUAGGCUCUU-GGGAGCUGCGAGTCGTGCTTTTGCATCCTGGAAATTTGGTGGAATTTTATTCTTTAAAGCAAAAACAAAAGAAAAGAAAGTTTGTCTGAG
........................................................................................................................ ...<<<<<<<<<<<<............................................>>>>.>>>>>>>>.. ................................................................................
U01829.1 0.00 .CATCCATCCCGCCCCAATCGCTCCCAGAGACTCACACCGGTCACTCTAACTATTAGTCTTCCATCCGGACCGCAACCGGTTCATTCCAACTCCATCCATCCTATTTCTAAACTACAGTAATCCTTTAAAAAATCCTAAAACTAGAATTTTTGGTTGGTTTATATGTATCAGATGCTTTCG GCCUGUUCCCUGAGACCUC..AAG-UGUGAGCGUUCUGAACAUGCUUCACGCCU-GGGCUCUCCGGGUACCAGGACGGTCTGAGCAGACACGTT
.................................................................................................................................................................................... ...........<<<<<<<<..<.<.<<<<<<..............>>>>>>>.>.>>>>>>>>..........< <<<<<<<....>>>>.>>>>
U01830.1 0.00 .AATAAATCTTATAGTTTTTAGATTCTAGACAATTTCTAGAGTTTTGGTTGGTTTATGAGTTTATGCTTCCG GCCUGUUCCCUGAGACCUC..AAG-UGUGAGUGUACUAUUGAUGCUUCACACCU-GGGCUCUCCGGGUACCAGGACGGTTTGAGCAGATCTTTTTTTCTGTTTTCACGGGGTTTTTTTTCACACTGGGAGCTAGTTCCAATAAAATGGTATTCGGGGAAAAGGGTCAAACGATTATTTTCAGAAGTCGAC
....................................................................... .....................<<<.<<<<<<<<...>>>>>>>>>>>...<<<<.<<<...>>>>>>>...... ....................................................<<<<....>>>>....................................................
U01837.1 0.00 .TCAATCTACCAACTATTTCCTGGGCTACAGTAACCCGAAGAGTTATCATATTCATCACATTCTAGACTTTCTGAGAAAGACTTTTGGTTGGTTTATATGTTCTGATGCTTTCG GCCUGCUCCCUGAGACCUC..AAG-UGUGAGCGCACUGUUGAUGCUUCACGCCU-GGGCUCUCUGGGUACCAGGACGGCTTGAGCAGACATTTTTTGATTCTGGTTTTGTAGTTTTTTAGGTTAAAACGTAGCTGAAACAAGTCAAATCATTGGTTTCAGA
................................................................................................................. ...........<<<<<<<<..<.<.<<<<<<..............>>>>>>>.>.>>>>>>>>........... ........................................<<<<<<............>>>>>>.......................
U01838.1 0.00 .TCAGCATGCGTCTTAACTATTCCCTACAGTAATCCTATCCCATTCCATCCTAAGTTATCTGGAAACATGGTTTGGTTGGTTTGATATGATACAGCTCACG GCCUGCUCCCUGAGACCUC..AAG-UGUGAGCGUACUGUAGAUGCUUCACACCU-GGGCUCUCUGGGUACCAGGACGGCGTATTTGAGCAACACTTTTTTCAGTTTTTTAAATTCATGTGGATTGGTTTAAGATTTAGAAATGTTTAGGTTTAACAGAGGGAGAATTC
.................................................................................................... ...<<<<<....................>>>>>......................................... .......<<<<<<<<<..............<<<<<<<<<<.................>>>>>>>>>>>>>>>>>>>..................