Seq ID Score (bits) Sequence
AC006590.11 0.00 .UGUGGACAACAAAGAAAGUGUUCUGAGCCAAACUAUUGUUAAAUAUCAUUACGAAUGCCAAAGUAUGUAAAUGCAACCGGGCAUAUGUAAAUAUUGGCAUUGGUGACAUGUGCAAAUGUUUGUAUG GCUGAUUCCCUGAGACCCU..AACUUGUGACUUUU-AAUACCAGUUUCACAAGUUUUGAUCUCC-GGUA-UUGGACGCAAACUUGCUGAUGUUAGUAAAAAAUAAGGCAAAAACGAAUUCCCUUUCAAGGCACAAGUAUCGGCAAUUC
.............................................................................................................................. ..<.<..<<.............<<..<<<<................>>>>..>>...........>>....>.> ..........................................................................
AC018755.3 0.00 .GUUUUUGGUCUUUCUGUCUCUGGCUCUCAGAAUGUCUCUGUGCCUAUCUCCAUCUCUGACCCCCACCCCAGGGUCUACCGGGCCACCGCACACCAUGUUGCCAGUC UCUAGGUCCCUGAGACCCUuuAACCUGUGAGG----ACAUCCAGGGUCACAGGUGAGGUUCUU-GGGAGCCUGGCGUCUGGCCCAACCACACACCUGGGGAAUUGCUGGCCUGACUUCUGACCCCUGACUCCUCAUACCCUUCCUCCAGAGCAUGACAUUUGACCACC
.......................................................................................................... .<<<<..<<<.......<<...<<..<<<<................>>>>..>>.>>.......>>>...>>>> ..............................................................................................
AC122451.3 0.00 .CUCUAAUUCCCAAGCUGUCCGUUUACCUGGAAGAAGAAUUCUCCUGCAUCACACGAGACUUU GCCUAGUCCCUGAGACCCU..AACUUGUGAGGUAU-UUUAGUAACAUCACAAGUCAGGUUCUU-GGGACCUAGGCGGAGGGAUACCAGCAGCUUGGGACCUUAUUGAUUCUCGGCAUAAACCACCAGAACAAAAGAACAGGCAUAGAUUCUGCAUAGGCGCAAAGAACAAUGGUUUUCUUUCUAAUCAGCAAGGGUUUCACCAUGACAACAC
.............................................................. .<<<<..<<<.......<<...<<..<<<<................>>>>..>>.>>.......>>>...>>>> ..........................................................................................................................................
AP000962.2 0.00 .UUAGUCUAUAAAUGGUCGUCGUGAUUACUCAGCUCAUCCUAACUUUUAUAUAUCAUAUAUAUUUCUACUGAAGUAUUUUAAAUAGUAUUUAGAGGUAAAAGUCUAAGUGAACCCAACUGUAAUUUCUAAGCUAUCCUUAUUUCUGGAAGAAGAAUUCUACCGCAUCAAACCAGACUUU UCCUAGUCCCUGAGACCCU..AACUUGUGAGGUAU-UUUAGUAACAUCACAAGUCAGGCUCUU-GGGACCUAGGCGGAGGGGAACCAGCAGCUUUG
.................................................................................................................................................................................. .<<<<..<<<.......<<...<<..<<<<................>>>>..>>.>>.......>>>...>>>> ......................
AP001359.4 0.00 .UAGAGAAGAAAUACCAUACCACCUGUUUGUUGCAUCUUAGUUAUGAACCUCGAACAGAAAUUGCCUGUCAUUCUUGUUUUGCUUUGCUUUGUCUCAAGAAAGAAAACAUUGUUGCGCUCC UCUCAGUCCCUGAGACCCU..AACUUGUGAUGUUUACCGUUUAAAUCCACGGGUUAGGCUCUU-GGGAGCUGCGAGUCGUGCUUUUGCAUCCUGGAAAUUUGGUGGAAUUUUAUUCUUUAAAGCAAAAACAAAAGAAAAGAAAGUUUGUCUGAG
........................................................................................................................ .<.<<..<<<.......<<...<<..<<<..................>>>..>>.>>.......>>>...>>.> ................................................................................
U01829.1 0.00 .CAUCCAUCCCGCCCCAAUCGCUCCCAGAGACUCACACCGGUCACUCUAACUAUUAGUCUUCCAUCCGGACCGCAACCGGUUCAUUCCAACUCCAUCCAUCCUAUUUCUAAACUACAGUAAUCCUUUAAAAAAUCCUAAAACUAGAAUUUUUGGUUGGUUUAUAUGUAUCAGAUGCUUUCG GCCUGUUCCCUGAGACCUC..AAG-UGUGAGCGUUCUGAACAUGCUUCACGCCU-GGGCUCUCCGGGUACCAGGACGGUCUGAGCAGACACGUU
.................................................................................................................................................................................... .<<<<..<<<.......<<...<<..<<<<................>>>>..>>..>>......>>>...>>>> ....................
U01830.1 0.00 .AAUAAAUCUUAUAGUUUUUAGAUUCUAGACAAUUUCUAGAGUUUUGGUUGGUUUAUGAGUUUAUGCUUCCG GCCUGUUCCCUGAGACCUC..AAG-UGUGAGUGUACUAUUGAUGCUUCACACCU-GGGCUCUCCGGGUACCAGGACGGUUUGAGCAGAUCUUUUUUUCUGUUUUCACGGGGUUUUUUUUCACACUGGGAGCUAGUUCCAAUAAAAUGGUAUUCGGGGAAAAGGGUCAAACGAUUAUUUUCAGAAGUCGAC
....................................................................... .<<<<..<<<.......<<...<<..<<<<................>>>>..>>..>>......>>>...>>>> ....................................................................................................................
U01837.1 0.00 .UCAAUCUACCAACUAUUUCCUGGGCUACAGUAACCCGAAGAGUUAUCAUAUUCAUCACAUUCUAGACUUUCUGAGAAAGACUUUUGGUUGGUUUAUAUGUUCUGAUGCUUUCG GCCUGCUCCCUGAGACCUC..AAG-UGUGAGCGCACUGUUGAUGCUUCACGCCU-GGGCUCUCUGGGUACCAGGACGGCUUGAGCAGACAUUUUUUGAUUCUGGUUUUGUAGUUUUUUAGGUUAAAACGUAGCUGAAACAAGUCAAAUCAUUGGUUUCAGA
................................................................................................................. .<<<<..<<<.......<<...<<..<<<<................>>>>..>>..>>......>>>...>>>> .......................................................................................
U01838.1 0.00 .UCAGCAUGCGUCUUAACUAUUCCCUACAGUAAUCCUAUCCCAUUCCAUCCUAAGUUAUCUGGAAACAUGGUUUGGUUGGUUUGAUAUGAUACAGCUCACG GCCUGCUCCCUGAGACCUC..AAG-UGUGAGCGUACUGUAGAUGCUUCACACCU-GGGCUCUCUGGGUACCAGGACGGCGUAUUUGAGCAACACUUUUUUCAGUUUUUUAAAUUCAUGUGGAUUGGUUUAAGAUUUAGAAAUGUUUAGGUUUAACAGAGGGAGAAUUC
.................................................................................................... .<<<<..<<<.......<<...<<..<<<<................>>>>..>>..>>......>>>...>>>> ..............................................................................................