Seq ID Score (bits) Sequence
AC018755.3 0.00 .GAACCGACCUUGCGGGGCCUUCGCCGCACACAAGCUCGUGUCUGUGGGUCCGUGUCGGGGGCUCACCAUCGCGGCUGGGGCCUCCCCGGCCCUCCCCCUCAUCCCUGGUCCUCCUGGUCCCUGUCUGUCUGUCUGUCGGGUCUGUCCACCUGCCGCGCCCC CCGGGCUGAGGUAGGAGGUUGUAUAGUUG-.AGGAG...----GACACCC..--AAGGAGAUCACUAUACGGCCUCCUAGCUUUCCCCAGGCUGCGCCCUGCACGGGACGGGGCCCGGCGGGGACCCC
..............................................................................<.............>.........................................<<...............>>.<<<...< <......>........<<..<..<<<......<..............>.<.......>......>>>.........>.......>>... >....>>.......>.............<.........>
AC048341.22 0.00 .GCGCGCCGGGAGUAGCCGAGCCGCUGGGUGCUGGGCGGGGUCUCCGGGCGCGGCGCGGGGGGAAGGCAAAGGAAAAGAAGGGGCGGCGGGCCGACGUCGGCGGCGAGGAAGGACGGAGGAGCGCCGGAGCCGCUUUGCUGCCCUCCGCGUGGUCCCGUGCCUCCCCGACACCAUGGC CCUGGCUGAGGUAGUAGUUUGUGCUGUUGGuCGGGUug.UGACAUUGCCC.gCUGUGGAGAUAACUGCGCAAGCUACUGCCUUGCUAGUGCUGGUGAUGCUCAGCGCCGCGG
.......................................<.............>.........................................<<...............>>.<...<...<<......>........<<.......<<<....<.......>......<...>. .....>>>....................>>...>.....>.........>....................................... .......................
AC094021.2 0.00 .CGUUUCCUUUUGCCUGAUU CCAGGCUGAGGUAGUAGUUUGUACAGUUUG.AGGGUcuaUGAUACCACCCggUACAGGAGAUAACUGUACAGGCCACUGCCUUGCCAGGAACAGCGCGCCAGCUGCCAAGUGGGGCUGAGAGGAUGGCGUCACCCUGCUCAUCUCUGGGAAACCAGGUAAUGGGGAGGAAGUCUUUUUCUUCUUAGGGCAGGUGAGUCAUUGUUAGCAGUAGAAUAACUAGAAAUACUUCGUAGUUGUCAUUCAAGAAGUUUGAAGAUGUUUUCAAGGAA
................... ......................<..............>........................................<<......... ......>><..<....<<......>........<<..<..<<<....<.......>...............>>>.........>.......>>...>......>.......>.............<..........>............................................
AF210771.1 0.00 .UUGGAGAAUGACCUCCCGAGGAGAGCUCCCCACUUUUUUUCAGCAUUUUUUCCUCACUUUUAGGAAUUCAUAUUACCCUCGGACCCUUGAAUAUGUAGUAUUUCCCCCUUGGUCCCUUCUCAUAUACCAUACUACAUUUCUUUCAAAACUAACCGGGAUUUUUCAGGGGAUUGCAGGAUGAUGGCUCUACACUGGGG UACGGU-GAGGUAGUAGGUUGUAUAGUUU-.AGAAU...----AUUACUC..--UCGGUG--AACUAUGCAAGUUUCUACCUCACCGAAUAC
..........................................<.............>........................................<.................>.<..<<...................<<..<..<<<....<.......>......<...>......>>>........>.... ...>>.........>.>.......>......................<...........>............................. ...
AL049853.1 0.00 .GGCGUCCCAGCCCCCUGCGCCCACCGCGCCUGCCCGCCAGAAUCCCUGUGCCCUUGGUGCGUGUGGCCUGCCGAGCCUCGAGCCCCUGUUCUCCUCAGCCCUCUUUCCUCCCGCGUCCCCAGGAGGUGCCUCUGGAAGCCACGGAGUCCCAUCGGCACCAAGACCGACUGCCCU UUGGGGUGAGGUAGUAGGUUGUAUAGUUUG.-GGGC...----UCUGCCC.uGCUAUGGGAUAACUAUACAAUCUACUGUCUUUCCUGAAGUGGCUGUAAUAUCUGCGGUGGACA
.......................................................................................<.............>...........................................<<...............>>.<..<<...< <......>........<<..<..<<<......<..............>.....<...>......>>>.........>.......>>... >....>.>.......>..........
AL158152.18 0.00 .CCAGAUAACUUUUCAAAAGCAUUAGUUAAAGAAUUCUGAUUAGUUUGAAUUAGAAACAAAACUCAAAGAACAUGACCUAAUUUAACAGGUUAAUUUGAAGUGCAUCUGCCAAGUAGAAGACCAGCAAGAAAAAAAAAAUGGGUUC CUAGGAAGAGGUAGUAGGUUGCAUAGUUUU.AGGGCag.GGAUUUUGCCC..ACAAGGAGGUAACUAUACGACCUGCUGCCUUUCUUAGGGCCUUAUUAUUCACCGAUAACCUGUUUCCUUGCUACUUUGCUUUGGUGUAAGCA
..........................................................<.............>..................................................................<<...< <......>........<<..<..<<<.....<............>........<...>......>>>.........>.......>>... >....>.........>.............<..........>..............
AP000962.2 0.00 .AUAUUAUAUCUAUAUCCUUGCCAAGCCCUUAGGUGUAUGGCUGCCAUAUUUGGAGGAGCUGACUGAAGAUAUGAUAAGGAGUUUGAAGCAACAUUGGAAGCUGUGUGCAU CCGGGUUGAGGUAGUAGGUUGUAUGGUUU-.AGAGU...----UACACCC..--UGGGAGUUAACUGUACAACCUUCUAGCUUUCCUUGGAGCACACUUGAGCCGUCGAGGAAUUCUUCAUCACUUUAACCUGAUUGAGCCAAUUUGUGUGCAAGAAGGUAAUGUGUCAUGAGUAUCUU
............................................<.......>..................................<............>.<..<<... <<.....>........<<..<..<<<......<..............>.<.......>......>>>.........>.......>>... >....>>.......>.............<.........>...................................................
AP001359.4 0.00 .UCAGACUCUUUGAUAUGUUGUCUCUUAUGAAUGGCCCAAAUAGGUGACAGCACGAUGAAUCAUUAUAAGACUAACUUGUAAUUUCCCUGCUUAAGAAAUGGUAGUUUUCCAGCCAUUGUGACUGCAUGCUC CCAGGUUGAGGUAGUAGGUUGUAUAGUUU-.AGAAU...----UACAUCA..--AGGGAGAUAACUGUACAGCCUCCUAGCUUUCCUUGGGUCUUGCACUAAACAACAUGGUGAGAACGAUCAUGAUUCCUCCAGGCCUUUUCUCCCUAUGAAAGGUA
...................................................<.............>.....................................<<...............>>.<..<<... <<.....>........<<..<..<<<......<..............>................>>>.........>.......>>... >....>>.......>.............<......>.................................
Z70203.2 0.00 .UUAUAUGUCUAAUUUAACAACAAGUACUAAUCCAUUUUUCAGGCAAGCAGGCGAUUGGUGGACGGUCUACACUGUGGA UCCGGU-GAGGUAGUAGGUUGUAUAGUU--.-UGGA...--AUAUUACCA..--CCGGUG--AACUAUGCAAUUUUCUACCUUACCGGAGACAGAACUCUUCGAAGCUGCGUCGUCUUGCUCUCACAACUUUCUUUUCGUUUUCUUCCUCCUCUUACUUUCACCUCUUUGUUUUUCUUUAUUUUGUGCUAUCAAUUCGGAGUCGCAAGAAC
...........................................<.............>.................... ....................<<........................>>.<......<<.....<...............<...<..<.< ....<.......>....<...>......>.>.........>........>...>....>.>.......>.............<.......>...............................