Seq ID Score (bits) Sequence
AC018755.3 1.00 .GAACCGACCUUGCGGGGCCUUCGCCGCACACAAGCUCGUGUCUGUGGGUCCGUGUCGGGGGCUCACCAUCGCGGCUGGGGCCUCCCCGGCCCUCCCCCUCAUCCCUGGUCCUCCUGGUCCCUGUCUGUCUGUCUGUCGGGUCUGUCCACCUGCCGCGCCCC CCGGGCUGAGGUAGGAGGUUGUAUAGUUG-.AGGAG...----GACACCC..--AAGGAGAUCACUAUACGGCCUCCUAGCUUUCCCCAGGCUGCGCCCUGCACGGGACGGGGCCCGGCGGGGACCCC
................................................................................................................................................................. .......<<<<<<<<<<<<<<<<<<<.<<..<.............................>>>>>>>>>>>>>>>>>.>>>>>..... .......................................
AC048341.22 1.00 .GCGCGCCGGGAGUAGCCGAGCCGCUGGGUGCUGGGCGGGGUCUCCGGGCGCGGCGCGGGGGGAAGGCAAAGGAAAAGAAGGGGCGGCGGGCCGACGUCGGCGGCGAGGAAGGACGGAGGAGCGCCGGAGCCGCUUUGCUGCCCUCCGCGUGGUCCCGUGCCUCCCCGACACCAUGGC CCUGGCUGAGGUAGUAGUUUGUGCUGUUGGuCGGGUug.UGACAUUGCCC.gCUGUGGAGAUAACUGCGCAAGCUACUGCCUUGCUAGUGCUGGUGAUGCUCAGCGCCGCGG
.............................................................................................................................................................................<<<< .<<<<<.<<<<<<<<<<<<<<<<<.<<<<.<............................>.>>>>.>>>>>>>>>>>>>>>>>>>>>>. >>>>...................
AC094021.2 1.00 .CGUUUCCUUUUGCCUGAUU CCAGGCUGAGGUAGUAGUUUGUACAGUUUG.AGGGUcuaUGAUACCACCCggUACAGGAGAUAACUGUACAGGCCACUGCCUUGCCAGGAACAGCGCGCCAGCUGCCAAGUGGGGCUGAGAGGAUGGCGUCACCCUGCUCAUCUCUGGGAAACCAGGUAAUGGGGAGGAAGUCUUUUUCUUCUUAGGGCAGGUGAGUCAUUGUUAGCAGUAGAAUAACUAGAAAUACUUCGUAGUUGUCAUUCAAGAAGUUUGAAGAUGUUUUCAAGGAA
................... ......<<<<<<<<<.<<<<<<<<<<<<..................................>>>>>>>>>>>>.>>>>>>>>>..... .....................................................................................................................................................................................
AF210771.1 1.00 .UUGGAGAAUGACCUCCCGAGGAGAGCUCCCCACUUUUUUUCAGCAUUUUUUCCUCACUUUUAGGAAUUCAUAUUACCCUCGGACCCUUGAAUAUGUAGUAUUUCCCCCUUGGUCCCUUCUCAUAUACCAUACUACAUUUCUUUCAAAACUAACCGGGAUUUUUCAGGGGAUUGCAGGAUGAUGGCUCUACACUGGGG UACGGU-GAGGUAGUAGGUUGUAUAGUUU-.AGAAU...----AUUACUC..--UCGGUG--AACUAUGCAAGUUUCUACCUCACCGAAUAC
..................................................................................................................................................................................................... ..<<<<.<<<<<<<.<<.<<<<<<..........................................>>>>>>.>>.>>>>>>>>>>>.. ...
AL049853.1 1.00 .GGCGUCCCAGCCCCCUGCGCCCACCGCGCCUGCCCGCCAGAAUCCCUGUGCCCUUGGUGCGUGUGGCCUGCCGAGCCUCGAGCCCCUGUUCUCCUCAGCCCUCUUUCCUCCCGCGUCCCCAGGAGGUGCCUCUGGAAGCCACGGAGUCCCAUCGGCACCAAGACCGACUGCCCU UUGGGGUGAGGUAGUAGGUUGUAUAGUUUG.-GGGC...----UCUGCCC.uGCUAUGGGAUAACUAUACAAUCUACUGUCUUUCCUGAAGUGGCUGUAAUAUCUGCGGUGGACA
............................................................................................................................................................................<< <<<<<<.<<<<<<<<<<<<<<<<<<<<<..................................>>>>>>>>>>>>>>>>>>>>>>>>>>> >>........................
AL158152.18 1.00 .CCAGAUAACUUUUCAAAAGCAUUAGUUAAAGAAUUCUGAUUAGUUUGAAUUAGAAACAAAACUCAAAGAACAUGACCUAAUUUAACAGGUUAAUUUGAAGUGCAUCUGCCAAGUAGAAGACCAGCAAGAAAAAAAAAAUGGGUUC CUAGGAAGAGGUAGUAGGUUGCAUAGUUUU.AGGGCag.GGAUUUUGCCC..ACAAGGAGGUAACUAUACGACCUGCUGCCUUUCUUAGGGCCUUAUUAUUCACCGAUAACCUGUUUCCUUGCUACUUUGCUUUGGUGUAAGCA
...............................................................................................................................................<< <<<<<<<.<<<<<<<<<<<<<.<<<<<<.<..............................>.>>>>>>.>>>>>>>>>>>>>>>>>>>> >>.....................................................
AP000962.2 1.00 .AUAUUAUAUCUAUAUCCUUGCCAAGCCCUUAGGUGUAUGGCUGCCAUAUUUGGAGGAGCUGACUGAAGAUAUGAUAAGGAGUUUGAAGCAACAUUGGAAGCUGUGUGCAU CCGGGUUGAGGUAGUAGGUUGUAUGGUUU-.AGAGU...----UACACCC..--UGGGAGUUAACUGUACAACCUUCUAGCUUUCCUUGGAGCACACUUGAGCCGUCGAGGAAUUCUUCAUCACUUUAACCUGAUUGAGCCAAUUUGUGUGCAAGAAGGUAAUGUGUCAUGAGUAUCUU
.............................................................................................................. .......<<<<<<<.<<<<<<<<<<<<<..................................>>>>>>>>>>>>>.>>.>>>>>..... ..........................................................................................
AP001359.4 1.00 .UCAGACUCUUUGAUAUGUUGUCUCUUAUGAAUGGCCCAAAUAGGUGACAGCACGAUGAAUCAUUAUAAGACUAACUUGUAAUUUCCCUGCUUAAGAAAUGGUAGUUUUCCAGCCAUUGUGACUGCAUGCUC CCAGGUUGAGGUAGUAGGUUGUAUAGUUU-.AGAAU...----UACAUCA..--AGGGAGAUAACUGUACAGCCUCCUAGCUUUCCUUGGGUCUUGCACUAAACAACAUGGUGAGAACGAUCAUGAUUCCUCCAGGCCUUUUCUCCCUAUGAAAGGUA
................................................................................................................................... .......<<<<<<<.<<<<<<<<<<<<<..................................>>>>>>>>>>>>>.>>.>>>>>..... .....................................................................
Z70203.2 1.00 .UUAUAUGUCUAAUUUAACAACAAGUACUAAUCCAUUUUUCAGGCAAGCAGGCGAUUGGUGGACGGUCUACACUGUGGA UCCGGU-GAGGUAGUAGGUUGUAUAGUU--.-UGGA...--AUAUUACCA..--CCGGUG--AACUAUGCAAUUUUCUACCUUACCGGAGACAGAACUCUUCGAAGCUGCGUCGUCUUGCUCUCACAACUUUCUUUUCGUUUUCUUCCUCCUCUUACUUUCACCUCUUUGUUUUUCUUUAUUUUGUGCUAUCAAUUCGGAGUCGCAAGAAC
.............................................................................. <<<<<<.<<<<<<<.<<<<<<<<<..........................................>>>>>>>>>.>>>>>>>>>>>>> ..........................................................................................................................