Seq ID Score (bits) Sequence
AB006424.1 1.00 .ACCGUUUAUGCCACAUGUUGUAAAAUCAAGCUUGUCUUGUUCUUAUUUUCUCAAUAGGAAAAGAAGACGGGAUUAUUGCUUUA CCUAUAAUUAUAGCGCCCGAACUAAGCGCC......................................................CGGAAAA--...........................................................AG-GCUUAGUUGACGAGGAuGGAGG.-UUAUCGA.AUU-..UCG-CGGAU-.CCUCCCGGCUGaguGUGCAGaucaCAGCCGUAAG.AAUUUCU-UCAAACCAAGGGGGUGACUCCUUGAACAAAG.-AGAAAUCACAUGAUCUUCCAAAAAACAUGUAGGAGGGGACGAUUGAAAGUCCCCUUGAAAUUUGACUUUCUUCGUCUCCUUUUACAAUCUUAGGAGGAAGAAAAAUAUGUGUGGAAUCGUAGGUUAUAUCGGUC
................................................................................... ......................................................................................................................................................................................................................................................................................................... .....................................................................................................................
AC078934.3 1.00 .CAACUUUGUCAAAAUAAAUGUGACAAAAUUAAAUAAAGUGUCAUCAAUGUGACAGUAUAGAUAUUUUGAAAAAGUAAAACAAAAAAAUUGUUUUAGGAUUUUUAAAAUUUUAUUGUGAAAAUAUUUGCAAAACAAAACAACACCGUUGUACAAUAAUGAUUAAUGGAAAGGGGGAAAGUUCGGC AGUACAGUUAAAGCGCCUGUGCAAAUAAAUauuuguauuugaagauuaa...................................AGGUUAAUA...............................uaugaguggccuuuauagagugcaauauAUGUAUUUGUAGACGAGGA.GGAUAg-UGAUCGAaUAGA..UCGGCGGAUGcUAUCCCGGAUG...UGGCU-....CAUUCGUUAG.CUUAUUAAGUAAAACAUUAGGGUGACUUAAUGGACAAAG.UUAAUAAGAUCGCCAGAAAUUGAAUAUAAAAAAU
........................................................................................................................................................................................ ......................................................................................................................................................................................................................................................................................................... ................
AE007529.1 1.00 .AAGUAAUAGUAUAAUGACAAUGUCUUAUAGACAAGUAAAUUGUAGAGGAGGAAAGUAGUGUUAAA AUUAUAGUUAAAGCGCCCGAACUUGAGUGA......................................................--UAUAGU-...........................................................UCAUUUAAGUUGACGAGGA.UGGGG.AGAAUCGA.AUCU..UCGGCGGAUG.CCCCACGGUA-...CCGCAC....-UACCGUUAGcGGUUGG---UAAAAGCAGAAAGUGAUUUCUGUCACAAAG.--CCAAUCUGGUGUUAAAACCUAUUUUGUUAAAAGCCUAAAAUCCUUUAAAAAAGAGGUCGUUUUAGGUGUAUUAAAGUUAAUUUAAAAAUAAGAAGGGAAGAUUUUUAUGUGCGGAAUAGUUGGAUAUAGUGGU
................................................................. ............................................................................................................................................................................<<<<<..<.....................>..>>>>>........................................................................................ .....................................................................................................................
AE010557.1 1.00 .AAUAUAAUUUACCAUAGGAGAUU UAUGUAAAAGAAGCGCCAGAACUCU-----......................................................---UUUU--...........................................................-----AGAGUUGACGAGGA.UUGGAa-UUAUCGAaGUUU..UCGGCGGAUGuUCCAAAGGU--...GGUUAC....--AACC----.AUUAUCA-ACAAAAACACAGAGCAAUUUGUGUAACAAAG.-AGAUAAUAGUAACAAUCUCCUAUUUUAUAAUGAAAAUUUGUAGGAGGUUUUUUAAUG
....................... ......................................................................................................................................................................................................................................................................................................... ........................................
AE013165.1 1.00 .UGGCAAAAGAGCUGGCUGAUUUGAUAGAAAGAAAAUUGAACUGAUUUUUUGAAAGGAGGGAUGCCUAUAGAGGAAGAUGUAGAGUCGAGAUUUAAUGUAAGC UUUAAUUUAGAAGCGCCUGGACUUAAAGCC......................................................---UUAA--...........................................................GGCUUUAAGUUGACGAGGG.CAGGG.UUUAUCGA.GACA..UCGGCGGGUG.CCCUGCGGUC-...UUCCUG....CGACCGUUAGaGGACUG--GUAAAACCACA-GGCGAC-UGUGGCAUAGAG.--CAGUCCGGGCAGGAAAAUUUUAUAAACUCACAGUGAGAGGAGACGCAAUAUGUGUGGGAUUGUAGGAUAUAUAGGAGAUAAACAAGCAACACCUAUACUGCUGGAAGGUUUGAC
...................................................................................................... ..........................................................................................................................................................................<.<<<<<.<.<.<...............>.>.>.>>>>>>....................................................................................... ..................................................................................................
AE015944.1 1.00 .UAGUAAAAUUAAUUGAAAAGAAAACAAAAUAAUAUUAGCUUAAUGAUGGGUAGAGAUCCAUACUAUAAUUAAUGCAUUUCUAUCCAUUUUUA AAAUAUAAUAAAGCGCCAGGACUUAGGUGAugaaacucagacuauggucugaguaaguucgacuaaccaaaucacagauuuggaGUAAGAUUA.augaaacucagacuauggucugaguaaguuccaccaaccaaaucacagauuuggggugUCACUUAAGUUGACGAGGA.UGGGG.AGUAUCGA.AUCU..UCGGCGGGUG.CCCCACGGUA-...CUGCAC....-UACCGUUAAaGAUUGA---CAAAACCAAGGAGUAAUUUUUGGUACAAA-.--UCAAUCAGGUGUUAAAACCUUAAAAAAAGAAAGGAAGAUGAAUAUGUGCGGAAUAGUUGGAUACAUUGGAAAAAAGGAAGCUGCACCAAUUUUAGUUGAGGGAUUAUCAAAGUUAGAAUACAGA
............................................................................................ ......................................................................................................................................................................................................................................................................................................... ............................................................................................................
AE016953.1 1.00 .GACCAAUUUUCGGUUUUUAGAUUUUUGUUGACAAGUACCUACUUUUAAUUGUAUGAUUGUUUAUGUUUCUACGGAAUAUAUUUACAAAGGAGGUAUAUAGAC CAAUAUCGGAUAGCGCCAGACCUGA-----......................................................---ACGU--...........................................................-----UCAGGUGACGAGGAgAGAGC.-UUAUCGA.AGAU..UCGGCGGGUG.GCUCUAGGG--...ACUGCA....--CUCUACA-.GAUAACAAAGAAAAACUAAUUGUGAAGUUAGA-ACAAAG.CGGUUAUCACGCAGGUAGAAACAUAUAAUGGGAUUUGCUAGUUAAACAGGACCUAGUAAAUACAGAAUUUCAAUUGGAAAGUAGGAAUUAGCAUUAUGUGUGGAAUUGUCGGAAUG
...................................................................................................... ............................................................................................................................................................................<<<<<..<......................>.>>>>>........................................................................................ ..................................................................................................
AE016998.1 1.00 .AUAGACGAUGAAAAAAAUUUCAUUGACGGUUUAUCCAUGUUUGUUAUAAGAUGGUCUUGUUCUUUUUCUCAAAGGAAAUAUUG UAAAUUAUAAAAGCGCCAGAACUACA----......................................................--AAUAG--...........................................................----UGUAGUUGACGAGGU.GGGGU.-UUAUCGA.GAUU..UCGGCGGAUG.ACUCCCGGUUGu..-UCAUC...aCAACCGCAA-.GCUUUUACUUAAAUCAUUAAGGUGACUUAGUGGACAAAG.GUGAAAGUGUGAUGAGAGAAGAGGCACGGAUGAAAACUAGCUGUAUAAGUAUAUACGGACUUAAACCCAAUCGAGAGGAAGGUGAAAGCCGUUCCAAGCUUACAGGGCUAGCAAUAUGUAAUCCGUUUUUUAGUA
................................................................................... ..........................................................................................................................................................................<.<<<<...<<<<<...............>>>>.>.>>>>>...................................................................................... .....................................................................................................................
AE017024.1 1.00 .AUGUUUGUUAUAAGAUGGUCUUGUUCUUUUUCUCAAAGGAAAUAUUG UAAAUUAUAGAAGCGCCAGAACUACA----......................................................--AGUAG--...........................................................----UGUAGUUGACGAGGU.GGGGU.-UUAUCGA.GAUU..UCGGCGGAUG.ACUCCCGGUUGu..-UCAUC...aCAACCGCAA-.GCUUUUACUUAAAUCAUUAAGGUGACUUAGUGGACAAAG.GUGAAAGUGUGAUGAGAGAAAAGGAACGGAUACAAACUAGCUGUAUAAGUAUAUACGGACUUAAACCCAAUCGAGAGGAAGGUGAAAGCCGUUACAAGCUUACAGGGCUAGCAAUAUGUAAUCCGUUUUUUAGUAUAAAUAAAAAUGGUAUCGGACUAUGUCGUUACAUGU
............................................... ......................................................................................................................................................................................................................................................................................................... .........................................................................................................................................................
AF270378.1 1.00 .AACAGAAUUUUAUCUUUUAAAAAGAUUUGAAAAAUAUAUUUUUUUAUUUUGAGAAUAAUUCAUCGAUGUAUCUAUUCAGAACUAUUACUAUUUGUGAAAAAUACUGUUAAAUCGUUUGCAAAUUAAUUCGUUGACAGUGUACAAUGAAUAUUAAUGGAAAGGAGGAGAGUCUAGGUUA UUAAUAAUUAAAGCGCCUGUGCAAAAUACCuaaauaguuaucaaguauuaaaa...............................GUUAAAAUA...................................guagaacuuuuauagauaacgauuUGGAUUUUGUAGACGAGGA.GGAUAg-UGAUCGA.AUCAgaUCGGCGGAUGcUAUCCCGGAUG...UGGCA-....CAUUCGUUAG.CUUAUUAAGUAAAUCAUUAAGGUGACUUAGUGGACAAAG.UUAAUAAGAUCGCCAAACUAAAUAAAUUAUUUUGGGAAAC
.................................................................................................................................................................................. ......................................................................................................................................................................................................................................................................................................... ......................
AL596166.1 1.00 .UAAAACCAUACGGCUCGCUCCUUUUUCUAUCAUAACUAUAUUAUUAGUCAUUUGUUUUUUUUUGUCAAUGUAUAGACCAAUUUUAAACAAACGGCUAUAUAUAAUGCUUGACCUAGUAUACAUAUUAUUGUAAAAUAGAUUUGUUUCCUUGAAAAGUAUUGAAGGAGGAUAGUAC AACUGAAUAGAAGCGCCAGAACUGAUUGGG......................................................ACGAAAAUG.................................cuuaaaggugaaauuccuggaaaguaAACAAUCAGUUGACGAGGA.GGAGA.UUAAUCGA.AAUU..UCGGCGGGAG.UCUCCCGGCUG...UGCAUG....CAGUCGUUAAgUCUUACUUACAAAUCAUUUGGGUGACCAAGUGGACAGAG.UAGUAAUGAAACAUGUGCAAGAACCCUCCAAGGAAACCAAAAA
............................................................................................................................................................................... ......................................................................................................................................................................................................................................................................................................... .........................
AL935254.1 1.00 .UUGUUGACUUUUAUUACAUGUAACGGUAAAGUUAACUUGUUUCUAGGAAAUAUACCAAUCGGAGGUUAGACUAGACCAAUUGUUAAUUGGU UAAAGCGGAAUAGCGCCAGGACUUUAG---......................................................---AAU---...........................................................---CUAAAGUUGACGAGGAuGACGU.-UUAUCGA.UAA-..UCGACGGGUG.ACGUCAGGG--...ACUGCA....--CUCUACA-.GGUCAAUUACAAAAACCGACUGUGAGGUUGGUGACAGAUaUAUUGACCACGCAGCUAGAAACAAUUCAAACAGUAAAGGAAGAUUAAUUUAUGUGUGGAAUUGUUGGUGUAACGGGUAAAGAUAGUGCAGUAUCAAUCUUACUGAACGGAUUGGAAAAGUUGGAAUA
........................................................................................... ...........................................................................................................................................................................<<<<<<..<......................>.>>>>>>....................................................................................... .............................................................................................................
AP001507.1 1.00 .CGUUGUAUGUUGCUUGCGCAUAUUUUGUAGUAGUUGUUUGAAAAUGUUGAUCAGUCUGAAUGAAACAAAAAAAGUUUGGAGAUUUGUUGGGAAUGAUUGACGUGCAGACAACAAUUAGGUAUGAUUAGCCUGUCGAAGAUAGAAAGGAGGAUCGCAACAGAGGGAGACCUCU AUGACAGUUGAAGCGCCAGGACUAUUCCA-......................................................CGGACGGUA...........................................................ACGGAAUAGUUGACGAGGA.GAGGG.UUUAUCGA.AGGU..UCGGCGGAUG.CCCUCCGGUUGc..-ACAUG...aCAGCCGCAA-.GCUUUUGUAAAAAACAGAGGGGCGACCUUCUGGACAAAG.GCAAAAGCGUUCAUGCUAACAAAAAAGAGAUAAAGAGUGGGGCAAG
............................................................................................................................................................................ ............................................................................................................................................................................<<<<<.<.<.<...............>.>.>.>>>>>........................................................................................ ............................
AP004593.1 1.00 .UAAGUAAUGAAAGUCCGAAAGCAAGGGCAACUAUCAUGGAAAGGAGCUUUUAGAGCAAAUUUUAGGGA CUAUAAUCAAAAGCGCCAGGACUAUUCUUC......................................................GGACGGAUAg..........................................................GAAGGAUAGUUGACGAGGUaGGAGG.-UUAUCGA.AUUU..UCGGCGGGUG.CCUCCCGGCUG...UCAUCA....CAGUCGAAA-.CUUUAUCACUAAAACAGUAGGGUGACCUAUUGCACAAAA.GGAUAAAGAAAGAUGUCUUAUCAAAUAAUAAAAUACACGAGAAAGGGGCAACAAGAGGCCCCUAUGUAAUAAAGUUGGUGUUCGCAAGGGUUUUCAAAAAAAUUACUCUAUUGAACACUCACUUAAAGUCGGUCUUUUUGUCUGCCCCUU
.................................................................... ..................................................................................................................................................................<<<<.<<.<.<<<<<..<......................>.>>>>>.>.>>>...>>>............................................................................ ....................................................................................................................................