Seq ID Score (bits) Sequence
AB003157.1 0.00 .CUAGAGUCAUUUUUGAGC GCUUUCUCCCAGGUUUGGACUGGGGG-UUAGCCGACGCCCUGUGAGUU..ACCGCUCACGGGGCGUUCAACaUUUU..UCAG.GUAUUCGUGCAGCUUAUCGCUUCUUGCCGCCUGUGCGCUUUUUCGACGCGCGACGCUGCUGCCGAUUCGGUGCAGGUGGUGGCGGCGCUGACACGUCCUGGGCGGCCACGGCCACACGAAACGCGGCAUUUACGAUGUUUGUCAUGCCUGCGGGCACCGCGCCACGAUCGCGGAUAAUUCUCGCUGC
...<.............. <<<..<.<<<<<.......>>>>>.>.......<<<<<<<<<<<<<........>>>>>>>>>>>.>>.................... .....>>>...................................>.<<..........>>...........................................................................................................................
AB027714.1 0.00 .GCUGCCCUGGAAAUUUUCUCUGCCCAGGUGAGCGAGGAAUUCGCGGCGGUCUUCGCUCGUCCAGCCACGUGAUCGCAGCGCGAGCUCGGGAUGGGUGUCGAACAGAUCAGCGGAAAAUUUCCAGGCCGGUGUGUCAAUGUCUCGUGAAUCCGCUAGAGUCAUUUUUGAGC GCUUUCUCCCAGGUUUGGACUGGGGG-UUAGCCGACGCCCUGUGAGUU..ACCGCUCACGGGGCGUUCAACaUUUU..UCAG.GUAUUCGUGCAGCUUAUCGCUUCUUGCCGCCUGUG
.......................................................................................................................................................................... <<<..<.<<<<<.......>>>>>.>.......<<<<<<<<<<<<<........>>>>>>>>>>>.>>.................... .....>>>......................
AB027715.1 0.00 .AAUUCGCGGCGGUCUUCGCUCGUCCAGCCACGUGAUCGCAGCGCGAGCUCGGGAUGGGUGUCGAACAGAUCAGCGGAAAAUUUCCAGGCCGGUGUGUCAAUGUCUCGUGAAUCCGCUAGAGUCAUUUUUGAGC GCUUUCUCCCAGGUUUGGACUGGGGG-UUAGCCGACGCCCUGUGAGUU..ACCGCUCACGGGGCGUUCAACaUUUU..UCAG.GUAUUCGUGCAGCUUAUCGCUUCUUGCCGCCUGUGCGCUUUUUCGACGCGCGACGCUGCUGCCGAUUCGGUG
......................................................................................................................<.............. <<<..<.<<<<<.......>>>>>.>.......<<<<<<<<<<<<<........>>>>>>>>>>>.>>.................... .....>>>...................................>.<<..........>>........
AB084384.1 0.00 .UUUUGAGU GCUUUCUCCCAGCUGAUGACUGGGGG-UUAGCCGACGCCUCGACAGUU..ACAGCUGUCGGGGCGUUCAACaUUUU..UCAA.GUAUUGGUGCAGCUUAUCUGGUUUUUCUUUUAACUGCCUGGUUAUUUUGCGCGUUUUGUAUUCCGUUCAACCAGGUUUUAUCAAUCAUUGUCAGUGGAAGAUCCCUGCCGUUUUUCCCAAAGUCCGUGGAUGACUUCUAAAGCAGCAAUCACUGAU
........ <<<..<.<<<<<.......>>>>>.>.......<<<<<<<<<<<<<........>>>>>>>>>>>.>>.................... .....>>>......................................<<..........>>...........................................................................................
AF024666.2 0.00 .UCCGCCCGGUUGAUCGGGUAUACUCAUGUCUAG GCUUUCUCCCAGAUUGUGGCUGGGUGAUAAGCGAGCGUCGAUCCGGUU..GCCGCCGG-UCGGCGCUCAUUuUUUUauUCGG.UU---GACUUACAUCAGGGGUUAAGGGUCAAAAUGUGUGUCUGGCUCGGCGUGUCGCGGGGGUUAGAUUUGGCCUUUUUGAAUGCCGAUUGAGUGGGUGUAGUCGGUGUCGAUAGCGUUGUCGUAGAGGGCUGGGCGUCCUGUUUCGUGGUCGGCUUGGUUCUCGGUUUGGG
.................<............... ..<..<.<<<<<.......>>>>>.>......<<.<<<<<<<<.<<........>>>>.>>>>>>.>>.................... .....>......................................>.<<..........>>...........................................................................................................
AF121000.1 0.00 .GUCAUCGAGAUCACCUGUAAAUGAAGGGACCUCAGCGUGUCUGGUUGUGCCAGCCGCAUAGUCAUUGGGUAGACUCAUAACCAA GCUUUCCCCCAGGUUGUGACUGGGCGAUAAGCGAACACCUUACGAGAUugGACCCUCGUAGGGUGUUC---.UUUU..UUGU.GUAGUUGUUUUUCCCAGCUUAAAACACCCUGAACUAGUUUUUAUCCCUCCCACGCGGAAAAAUCGAAAAGUUAUUCAGAGAAUGAUCUAAAAAUGAAGAUGAGGUAGCGGUUUGUACUUUU
....................................................................<............... <<<..<.<<<<<.......>>>>>.>......<<.<<<<<<<<<.<.......>..>>>>>>>>>.>>.................... ..........>>>................................>.<<.........>>........................................................
AF164956.1 0.00 .CUGCAUAGUCAUUGGGUAGACUCAUAACCAA GCUUUCCCCCAGGUUGUGACUGGGUGAUAAGCGAACACCUUACGAGCUugGACCCUCGUAGGGUGUUC---.UUUU..UUGU.GUAGUUGUUUUUCCCAGCUUAAAACACCCUGAACUAGUUUUGAUCCUUCCCACGCGGAAAAAUCGAAAAGUUAUUCAGAGAAUGAUCUAAAAAUGAAGAUGAGGUAUCGGCUUGUACUUUUGUACAAGCGGAUACCUCAUCUUCUUCAGUCCCGCGUGACAUCCAUCAUGAGCG
...............<............... <<<..<.<<<<<.......>>>>>.>......<<.<<<<<<<<<.<.......>..>>>>>>>>>.>>.................... ..........>>>................................>.<<.........>>.............................................................................................................
AF364477.1 0.00 .GCGAUCGGGUAUAGUCAUGCUCAA GCUUUCUCCCAGGUUGGGACUGGGUGUAAAGCGAGCGUCGAACUGGUU..GCCGCCGGUUCGGCGCUCAUU.UUUU..UCGU.UU---CGACCAGCUUAAAUUACAUGCGUGUGUUUUAGGCGGUUACGCGCCGUUAUCCACGACACUUUCUUGGGGGAGAGCGUUCGCCUACUCGGCUUCUAGA
........<............... <<<..<.<<<<<.......>>>>>.>......<<.<<<<<<<<<<<........>>>>>>>>>>>.>>.................... .....>>>...............................>.<<..........>>..........................................
AF401314.1 0.00 .GUGGCCGUGGACAUGGAUGAAGACGCGGUGUGGGGUGUGCCGCGAAAAUUUUUUACUGUUCCAUUUGGGUCUAGGCCCUGUGAAACAACUGAUCCGGUUUGAUCAGGUAUAGUCAUACUCAA GCUUUCUCCCAGGUG-GGACUGGGGGUAAAGCGAGCGUCGAACUGGUA..GCCGCCGGUUCGGCGCUCAU-.UUUU..UCGU.UU---CGACCAGCUUAAAUUACAUGCGUGUGUUUUGGGCGGUUACGCGCCGUUAUCCACGACGCUUCCUUAAAGGGGGAGCAU
..........................................................................................................<............... <<<..<.<<<<<.......>>>>>.>......<<.<<<<<<<<<<<........>>>>>>>>>>>.>>.................... .....>>>...............................>.<<..........>>.......................
AF486522.1 0.00 .GGGUAUAGUCAUAGCUAG GCUUUCUCCCAGAUUGCGCCUGGGUGAUAAGCGAGCGUCGAACUGGUU..GCAGCCGGUUCGGCGCUCAU-.UUUU..UCGU.UU---AGACCAGCUUAAAUUACAUGCGUGUAUUUUUGGCUGUUACGCGCCGCUACCCACGACGCCUUCUCGGACAAGAGGCCAGCCGAUUCGGCUCCUAGA
..<............... <<<..<.<<<<<.......>>>>>.>......<<.<<<<<<<<<<<........>>>>>>>>>>>.>>.................... .....>>>...............................>.<<..........>>.........................................
AY048596.1 0.00 .CGUGCAGCGUCCCACGUGGCCGUGGACAUGGAUGACGGCGCGGUGUGGGGUGCACCGCGAAAAUUUUUUAAUGUUUCACACGGGUCUAGGCCACGUGAAACAACUGAUCCAAUGCGAUCGGGUAUAGUCAUGCUCAA GCUUUCUCCCAGGUUGGGACUGGGUGUAAAGCGAGCGUCGAACUGGUU..GCCGCCGGUUCGACGCUCAU-.UUUU..UCGU.UU---AGACCAGCUUAAAUUACAUGCGUGUGUUUUAGGCGGUUACGCGCCGUUAUCCACGACGCUUUC
.........................................................................................................................<............... <<<..<.<<<<<.......>>>>>.>......<<.<<<<<<<<<<<........>>>>>>>>>>>.>>.................... .....>>>...............................>.<<..........>>........
AY079086.1 0.00 .GGGGUGCACCGCGAAAAUUUUUUAAUGUUUCACACGGGUCUAGGCCACGUGAAACAACUGAUCCAAUGCGAUCGGGUAUAGUCAUGCUCAA GCUUUCUCCCAGGUUGGGACUGGGUGUAAAGCGAGCGUCGAACUGGUU..GCCGCCGGUUCGGCGCUCAUU.UUUU..UCGU.UU---CGACCAGCUUAAAUUACAUGCGUGUGUUUUAGGCGGUUACGCGCCGUUAUCCACGACACUUUCUUGGGGGAGAGCGUUCGCCUACUCGGCUUCUAGA
...........................................................................<............... <<<..<.<<<<<.......>>>>>.>......<<.<<<<<<<<<<<........>>>>>>>>>>>.>>.................... .....>>>...............................>.<<..........>>..........................................
AY263990.1 0.00 .UAAUGUUUCACACGGGUCUAGGCCACGUGAAACAACUGAUCCAAUGGGAUCGGGUAUAGUCAUGCUCAA GCUUUCUCCCAGGUUGGGACUGGGUGUAAAGCGAGCGUCGAACUGGUU..GCAGCCGGUUCGGCGCUCAUU.UUUU..UCGU.UU---CGACCAGCUUAAAUUACAUGCGUGUGUUUUAGGCGGUUACGCGCCGUUAUCCACGACGCUUUCUUAAGGGGAGGGCGUUCACCUACUCGGCUUCUAGA
.....................................................<............... <<<..<.<<<<<.......>>>>>.>......<<.<<<<<<<<<<<........>>>>>>>>>>>.>>.................... .....>>>...............................>.<<..........>>...........................................
AY266269.1 0.00 .GCAAUCAGACGUGCAGCGUCCCACGUGGCCGUGGACAUAGAUGACGGCGCGGUGUGGGGUGCACCGCGAAAAUUUUUUAAUGUUUCACACGGGUCUAGGCCACGUGAAACAACUGAUCCAAUGCGAUCGGGUAUAGUCAUGACCAA GCUUUCUCCCAGGUAGUGGCUGGGUGUAAAGCGAGCGUCGAACUGGUU..GCAGCCGGUUCGGCGCUCAUU.UUUU..UCGU.UU---CGACCAGCUUAAAUUACAUGCGUGUGUUUUAGGCGGUUACGCGCCGUUAUCCAC
..................................................................................................................................<............... <<<..<.<<<<<.......>>>>>.>......<<.<<<<<<<<<<<........>>>>>>>>>>>.>>.................... .....>>>...............................>..<..........>
X57320.1 0.00 .CGCGGCCUAGAUGAUCGCGUAAAAGGUCGCGGUCACUGGCAGAUGCUGGGGUGUUGUCCAGUCCACCACGGUCGCGCUCGACGCGGGUAGGUGUUUUAGUGUGCGCAUUCUGCGCAUGAGUCUGUAAACUCAUGACCGU GCUUUCUCCCAGGUGUGUGCUGGGUGAUAAGCGAAAGUC-AUCGGGUU..GCCGCCCGGU-GGCUUUCUUCgUUUU..UCAUuGUCUUUCCCUGACUCUAAAUGACACCGGUGUUAUUUACUAGCCAUGACACGCGAAAAAUAUGCCUU
...........................................................................................................................<............... <.<..<.<<<<<.......>>>>>.>......<<.<<...<<<<<.........>>.>>>.....>>.>>.................. ......>.>.................................>.<<.........>>....
X90817.1 0.00 .CAGCGCAUAGCUUCGGGGUGGGUGUCGAACAGAUCGGCGGACAAUUUCCACGCGCUAGCUGUGACUGUGUCCUGCGGAUCGGCUAGAGUCAUGUCUUGAGU GCUUUCUCCCAGCUGAUGACUGGGGG-UUAGCCGACGCCCUGUGAGUU..CCCGCUCACGGGGCGUUCAAC.UUUU..UCAG.GUAUUUGUGCAGCUUAUCGUGUUUUCUUCGUAAAUGAACGCUUAACUACCUUGUUAAACGUGGCAAAUAGGCAGGAUUGAUGGCCACACUCUUACUCAAAUUGC
.....................................................................................<............... <<<..<.<<<<<.......>>>>>.>.......<<<<<<<<<<<<<........>>>>>>>>>>>.>>.................... .....>>>....................................>.<<..........>>.......................................
Z22927.1 0.00 .UUUUGAGC GCUUUCUCCCAGGUUUGGACUGGGGG-UUAGCCGACGCCCUGUGAGUU..ACCGCUCACGGGGCGUUCAACaUUUU..UCAG.GUAUUCGUGCAGCUUAUCGCUUCUUGCCGCCUGUGCGCUUUUUCGACGCGCGACGCUGCUGCCGAUUCGGUGCAGGUGGUGGCGGCGCUGACACGUCCUGGGCGGCCACGGCACACGAAACGCGGCAUUUACGAUGUUUGUCAUGCCUGCGGGCACCGCCACGAUCGCGAUAAUUCUCGCUGCCGCUUCCAGCUCUG
........ <<<..<.<<<<<.......>>>>>.>.......<<<<<<<<<<<<<........>>>>>>>>>>>.>>.................... .....>>>.....................................<<..........>>.....................................................................................................................................