Seq ID Score (bits) Sequence
AF035198.1 0.00 .GACAAUCUCAGGGACCCUGACCCUCCAUUCCCCCCUUCUUCAAGCCUCUUCUUGAGGC UCAG.GUCGCCAGU-.GCGACACCCGUUCCCACACAACGGGC.AUU.GG.GGUGCAACUCCCCCGUCUAUCCUGAACGUCAUCAGGACCA
.......................................................... .........<........>....<<<<<.......>>>>>..........<<<<...><<...<<<.........>>>......>>>>>.
AF035199.1 0.00 .UUCCAUUGCUCAAACCACAGCUCCAACCCUAGCCACCUGUUCCGUGACUAUAACCGGAACUCUCACUCUUCACUCCCCCCUCCUUCAGGCAACCGCCUGAU CCAG.GUCGCCAGU-.GCGACACCCGUUCCCACACAACGGGC.AUU.GG.GGUGCAACUCCCCCGUCUAUCCUGGACGUCACCAGGACCA
..................................................................................................... .........<........>....<<<<<.......>>>>>..........<<<<...><<...<<<.........>>>......>>>>>.
AF035201.1 0.00 .CUUCGUAGG CCAG.GUCGCCAGU-.GCGACACCCGUUCCCACACAACGGGC.ACU.GG.GGUGCAACUCCCCCGUCUAUCCUGGACGUCACCAGGACCA
......... .........<........>....<<<<<.......>>>>>..........<<<<...><<...<<<.........>>>......>>>>>.
AF035402.1 0.00 .UUGUCUUCUCCUCUUCUCCAAGCCUCUUAAACCCCUGCAUCCUCCAUCUCCUAUGG UAAUuGUGGACAGUU.-CCACUCCCUUUAGCACACAAAGGUCcAAU.CG.GGUGCGACUCCCCCCCCUCCUGU--GGGCUACAGGAACCA
........................................................ .....<<<..........>>>..<<<<<.......>>>>>..........<<<<...><<<..<<<.........>>>.....>>>>>>.
AF035633.1 0.00 .AGCUCCUCGUCUUUUCCCCUGCCCCCGCCAAGGCAACCUCCGUCACCCUCGCCUCUCCUCAGAUCAGCGGCGAGGUUCUCUGCUCUUCCCAACUCCUCCAAGCCCUCUAGUGCACCCAGAACUUGGUUCUGCGCGGCCAAUGCGAUAAUUGGUAGUGUUUUCGGCUCCACUUAAAUCGAAGCCCG UAAUuGAGUCCAGU-.GACUCUCCCUCUAGCACACAGAGGUC.AAAcCG.GGUGCAAC-C-CCCCCUCCCCCCGUAGGUUAACGGGACCA
......................................................................................................................................................................................... .....<<<..........>>>..<<<<<.......>>>>>..........<<<<...>.<.<<..<<.........>>.....>>>>>>.
AF035635.1 0.00 .CCCCGAAACUCGUCCUCUCCGUCACCGCCCAACCAACCCCCCCCACCGCAUCGACCUGCAUAAUAACUGUAUCAGGAAUCUUAUCGAUGCACUCUCCGCUAAUCACGGACACUUCCACCUGAGUUCUCGAUCUCUAAAAUCG UCAG.CUCGCCAGUUaGCGAGGCCUGUUCCCACACAACAGGU.AAU.CG.GGUGCAACUCCCGCCCCUACUCCGAGGGUCAUCGGAACCA
.............................................................................................................................................. .......<.<........>.>..<<<<<.......>>>>>..........<<<<...><<<..<<<.........>>>.....>>>>>>.
AF035636.1 0.00 .CCGAAACUCGUCCUCUCCGUCACCGCCCAACCAACCCCCCCCACCGCAUCGACCUGCAUAAUAACUGUAUCAGGAAUCUUAUCGAUGCACUCUCCGCUAAUCACGGACACCUCCACCUGAGUUCUCGAUCUCUAAAAUCG UCAG.CUCGCCAGUUaGCGAGGCCUGUUCCCACACAACAGGU.AAU.CG.GGUGCAACUCCCGCCCCUACUCCGAGGGUCAUCGGAACCA
............................................................................................................................................ .......<.<........>.>..<<<<<.......>>>>>..........<<<<...><<<..<<<.........>>>.....>>>>>>.
D00637.1 0.00 .UCUCCUCUCCUUCAGGCCACAGCCUGAU UCAG.GUCGCCAGU-.GCGACACCCGUUCCCACACAACGGGC.AUU.GG.GGUGCAACUCCCCCGUCCAUCCUGGACGUCACCAGGACCA
............................ .........<........>....<<<<<.......>>>>>..........<<<<...><<...<<<.........>>>......>>>>>.
J04374.1 0.00 .UGCUCCCAGCUCUCCCUCCAAAACCCCAACCGCCACUAUCCAAAUCCAUGGCAAGCUCCGCUUGUCCUCCCCCCUCCUCCAAGCCAAUUAACUCUCUCUCCCUCAGCCACCACCUCGCUCCUCCCCCAUCUCCUAUGG UAAUuGCGGACAGUU.-CCGCUCCCUCUAGCACACAGAGGUC.CAUuUG.GGUGCGACUCCCCCCCC--UCCCGUGGGUCAACGGGAACCA
.......................................................................................................................................... .....<<<..........>>>..<<<<<.......>>>>>..........<<<<...><<<..<<<.........>>>......>>>>>> .
M15284.1 0.00 .AGGYYAAAAUCAG YAAU.GAAGGCAGUC.-CUUCUCCCUUUAGCACACAAAGGUC.AAA.UG.GGUGCGACUC-CCCCCCUUUUCCGAGGGUCAUCGGAAACC
............. .....<<<..........>>>..<<<<<.......>>>>>..........<.<<...><<.<..<<<........>>>.....>>>>.>.
M58309.1 0.00 UUAG.CUCGCCAGUUaGCGAGGUCUGUCCCCACACGACAGAU.AAU.CG.GGUGCAACUCCCGCCCCUCUUCCGAGGGUCAUCGGAACCA
.......<.<........>.>..<<<<<.......>>>>>..........<<<<...><<<..<<<.........>>>.....>>>>>>.
S97776.1 0.00 .AGUCACG UAAUuGAGGACAGUU.-CCUCUCCCUCUAGCACACAGAGGUC.AAAcUG.GGUGCAACUCCCCCCCC--UUCCGUGGGU-AACGGAAACCA
....... .....<<<..........>>>..<<<<<.......>>>>>..........<<<<...><.<..<<<.........>>>......>.>>>> .
U88845.1 0.00 .CUGCAUAAUAACUGUAUCAGGAACUCUCUCGAUGCACUCUCCGCUCAUCACGGACACUUCCACCUAAGUUCUCGAUCUUUAAAAUCG UUAG.CUCGCCAGUUaGCGAGGUCUGUCCCCACACGACAGAU.AAU.CG.GGUGCAACUCCCGCCCCUUUUCCGAGGGUCAUCGGAACCA
....................................................................................... .......<.<........>.>..<<<<<.......>>>>>..........<<<<...><<<..<<<.........>>>.....>>>>>>.
U88846.1 0.00 .CUCUCUCGAUGCACUCUCCGCUCAUCACGGACACUUCCACCUAAGUUCUCGAUCUUUAAAAUCG UUAG.CUCGCCAGUUaGCGAGGUCUGUCCCCACACGACAGAU.AAU.CG.GGUGCAACUCCCGCCCCUUUUCCGAGGGUCAUCGGAACCA
................................................................ .......<.<........>.>..<<<<<.......>>>>>..........<<<<...><<<..<<<.........>>>.....>>>>>>.
U88847.1 0.00 .UGCACUCUCCGCUCAUCACGGACACUUCCACCUAAGUUCUCGAUCUUUAAAAUCG UUAG.CUCGCCAGUUaGCGAGGUCUGUCCCCACACGACAGAU.AAU.CG.GGUGCAACUCCCGCCCCUUUUCCGAGGGUCAUCGGAACCA
....................................................... .......<.<........>.>..<<<<<.......>>>>>..........<<<<...><<<..<<<.........>>>.....>>>>>>.
U88848.1 0.00 .CACCGCUCCCCCCGCAUCGACCUGCAUAAUAACUGUAUCAGGAACUCUCUCGAUGCACUCUCCGCUCAUCACGGACACUUCCACCUAAGUUCUCGAUCUUUAAAAUCG UUAG.CUCGCCAGUUaGCGAGGUCUGUCCCCACACGACAGAU.AAU.CG.GGUGCAACUCCCGCCCCUUUUCCGAGGGUCAUCGGAACCA
............................................................................................................ .......<.<........>.>..<<<<<.......>>>>>..........<<<<...><<<..<<<.........>>>.....>>>>>>.
U88849.1 0.00 .UUCAAUUCAAUACCUUGACUCGCCCAAACUCCUCAUCUCCAUCACCGCUCAACCCACCGCUCCCCCCGCAUCGACCUGCAUAAUAACUGUAUCAGGAACUCUCUCGAUGCACUCUCCGCUCAUCACGGACACUUCCACCUAAGUUCUCGAUCUUUAAAAUCG UUAG.CUCGCCAGUUaGCGAGGUCUGUCCCCACACGACAGAU.AAU.CG.GGUGCAACUCCCGCCCCUUUUCCGAGGGUCAUCGGAACCA
.................................................................................................................................................................. .......<.<........>.>..<<<<<.......>>>>>..........<<<<...><<<..<<<.........>>>.....>>>>>>.
U88850.1 0.00 .ACCCCCGGGUCAAAGAUUCAAUUCAAUACCUUGACUCGCCCAAACUCCUCAUCUCCAUCACCGCUCAACCCACCGCUCCCCCCGCAUCGACCUGCAUAAUAACUGUAUCAGGAACUCUCUCGAUGCACUCUCCGCUCAUCACGGACACUUCCACCUAAGUUCUCGAUCUUUAAAAUCG UUAG.CUCGCCAGUUaGCGAGGUCUGUCCCCACACGACAGAU.AAU.CG.GGUGCAACUCCCGCCCCUUUUCCGAGGGUCAUCGGAACCA
.................................................................................................................................................................................. .......<.<........>.>..<<<<<.......>>>>>..........<<<<...><<<..<<<.........>>>.....>>>>>>.
U91413.1 0.00 .UUUCCGGUACCAUCACUCUCCACUCUCCUCUGCUUCAGGCCUCUUCCUCCUGAAG UUAG.CUCGCCAGU-.GCGAGGCCUCUUCCUACACAAGAGGU.AUU.GG.GGUGCGACUCCCCCGUCUAUCCUGAACGUCAUCAGGACCA
....................................................... .......<.<........>.>..<<<<<.......>>>>>..........<<<<...><<...<<<.........>>>......>>>>>.
V01418.1 0.00 .UUUAAAAUCG UUAG.CUCGCCAGUUaGCGAGGUCUGUCCCCACACGACAGAU.AAU.CG.GGUGCAACUCCCGCCCCUCUUCCGAGGGUCAUCGGAACCA
.......... .......<.<........>.>..<<<<<.......>>>>>..........<<<<...><<<..<<<.........>>>.....>>>>>>.
X54354.1 0.00 .ACUGACACCCCUAAACUCCUCAUCUACUCCACCGCCCCCUCCUACUCAACCUCCGCGACAUGUACACUGACCAUCCGCGGAAAGGUGAGGCUUCAUUCACCACUCCUCUCCUCCUCAUCCUCCUGAGCUUCGGCUCA UUAG.CUCGCCAGU-.GCGAGGCUCGUUCCCACACAACAAGU.AAU.GGuGGUGCAACUC-CCCCGUCCUCCCGAACGUCAUCGGGACCA
......................................................................................................................................... .......<.<........>.>..<.<<<.......>>>.>..........<<<<...><<.<.<.............>.....>>>>>>.
Y16104.1 0.00 .CUUUCUGAGGCUGGAAUCCUACUUCCCGUUUGACUCACGUUAAAGUCACG UAAUuGAGGACAGUU.-CCUCUCCCUCUAGCACACAGAGGUC.AAAcUG.GGUGCAACUCCCCCCCC--UUCCGUGGGU-AACGGAAACCA
.................................................. .....<<<..........>>>..<<<<<.......>>>>>..........<<<<...><.<..<<<.........>>>......>.>>>> .