Seq ID Score (bits) Sequence
AF035198.1 1.00 .GACAAUCUCAGGGACCCUGACCCUCCAUUCCCCCCUUCUUCAAGCCUCUUCUUGAGGC UCAG.GUCGCCAGU-.GCGACACCCGUUCCCACACAACGGGC.AUU.GG.GGUGCAACUCCCCCGUCUAUCCUGAACGUCAUCAGGACCA
.......................................................... ......................<<<<<<.......>>>>>>....<.<<.<<........>>>>>....<<<<<<......>>>>>>...
AF035199.1 1.00 .UUCCAUUGCUCAAACCACAGCUCCAACCCUAGCCACCUGUUCCGUGACUAUAACCGGAACUCUCACUCUUCACUCCCCCCUCCUUCAGGCAACCGCCUGAU CCAG.GUCGCCAGU-.GCGACACCCGUUCCCACACAACGGGC.AUU.GG.GGUGCAACUCCCCCGUCUAUCCUGGACGUCACCAGGACCA
..................................................................................................... ......................<<<<<<.......>>>>>>....<.<<.<<........>>>>>....<<<<<<......>>>>>>...
AF035201.1 1.00 .CUUCGUAGG CCAG.GUCGCCAGU-.GCGACACCCGUUCCCACACAACGGGC.ACU.GG.GGUGCAACUCCCCCGUCUAUCCUGGACGUCACCAGGACCA
......... ......................<<<<<<.......>>>>>>....<.<<.<<........>>>>>....<<<<<<......>>>>>>...
AF035402.1 1.00 .UUGUCUUCUCCUCUUCUCCAAGCCUCUUAAACCCCUGCAUCCUCCAUCUCCUAUGG UAAUuGUGGACAGUU.-CCACUCCCUUUAGCACACAAAGGUCcAAU.CG.GGUGCGACUCCCCCCCCUCCUGU--GGGCUACAGGAACCA
........................................................ ..........................................................................................
AF035633.1 1.00 .AGCUCCUCGUCUUUUCCCCUGCCCCCGCCAAGGCAACCUCCGUCACCCUCGCCUCUCCUCAGAUCAGCGGCGAGGUUCUCUGCUCUUCCCAACUCCUCCAAGCCCUCUAGUGCACCCAGAACUUGGUUCUGCGCGGCCAAUGCGAUAAUUGGUAGUGUUUUCGGCUCCACUUAAAUCGAAGCCCG UAAUuGAGUCCAGU-.GACUCUCCCUCUAGCACACAGAGGUC.AAAcCG.GGUGCAAC-C-CCCCCUCCCCCCGUAGGUUAACGGGACCA
......................................................................................................................................................................................... ..........................................................................................
AF035635.1 1.00 .CCCCGAAACUCGUCCUCUCCGUCACCGCCCAACCAACCCCCCCCACCGCAUCGACCUGCAUAAUAACUGUAUCAGGAAUCUUAUCGAUGCACUCUCCGCUAAUCACGGACACUUCCACCUGAGUUCUCGAUCUCUAAAAUCG UCAG.CUCGCCAGUUaGCGAGGCCUGUUCCCACACAACAGGU.AAU.CG.GGUGCAACUCCCGCCCCUACUCCGAGGGUCAUCGGAACCA
.............................................................................................................................................. .....................<<<<<<<.......>>>>>>>......<.<<<<.......>>>>>....<<<<<......>>>>>....
AF035636.1 1.00 .CCGAAACUCGUCCUCUCCGUCACCGCCCAACCAACCCCCCCCACCGCAUCGACCUGCAUAAUAACUGUAUCAGGAAUCUUAUCGAUGCACUCUCCGCUAAUCACGGACACCUCCACCUGAGUUCUCGAUCUCUAAAAUCG UCAG.CUCGCCAGUUaGCGAGGCCUGUUCCCACACAACAGGU.AAU.CG.GGUGCAACUCCCGCCCCUACUCCGAGGGUCAUCGGAACCA
............................................................................................................................................ .....................<<<<<<<.......>>>>>>>......<.<<<<.......>>>>>....<<<<<......>>>>>....
D00637.1 1.00 .UCUCCUCUCCUUCAGGCCACAGCCUGAU UCAG.GUCGCCAGU-.GCGACACCCGUUCCCACACAACGGGC.AUU.GG.GGUGCAACUCCCCCGUCCAUCCUGGACGUCACCAGGACCA
............................ ......................<<<<<<.......>>>>>>....<.<<.<<........>>>>>....<<<<<<......>>>>>>...
J04374.1 1.00 .UGCUCCCAGCUCUCCCUCCAAAACCCCAACCGCCACUAUCCAAAUCCAUGGCAAGCUCCGCUUGUCCUCCCCCCUCCUCCAAGCCAAUUAACUCUCUCUCCCUCAGCCACCACCUCGCUCCUCCCCCAUCUCCUAUGG UAAUuGCGGACAGUU.-CCGCUCCCUCUAGCACACAGAGGUC.CAUuUG.GGUGCGACUCCCCCCCC--UCCCGUGGGUCAACGGGAACCA
.......................................................................................................................................... .....................................................................<<<<<<......>>>>>>... .
M15284.1 1.00 .AGGNNAAAAUCAG YAAU.GAAGGCAGUC.-CUUCUCCCUUUAGCACACAAAGGUC.AAA.UG.GGUGCGACUC-CCCCCCUUUUCCGAGGGUCAUCGGAAACC
............. ....................................................................<<<<<<<......>>>>>>>..
M58309.1 1.00 UUAG.CUCGCCAGUUaGCGAGGUCUGUCCCCACACGACAGAU.AAU.CG.GGUGCAACUCCCGCCCCUCUUCCGAGGGUCAUCGGAACCA
.....................<<<<<<<.......>>>>>>>......<.<<<<.......>>>>>...<<<<<<......>>>>>>...
S97776.1 1.00 .AGUCACG UAAUuGAGGACAGUU.-CCUCUCCCUCUAGCACACAGAGGUC.AAAcUG.GGUGCAACUCCCCCCCC--UUCCGUGGGU-AACGGAAACCA
....... .....................................................................<<<<<<......>>>>>>... .
U88845.1 1.00 .CUGCAUAAUAACUGUAUCAGGAACUCUCUCGAUGCACUCUCCGCUCAUCACGGACACUUCCACCUAAGUUCUCGAUCUUUAAAAUCG UUAG.CUCGCCAGUUaGCGAGGUCUGUCCCCACACGACAGAU.AAU.CG.GGUGCAACUCCCGCCCCUUUUCCGAGGGUCAUCGGAACCA
....................................................................................... .....................<<<<<<<.......>>>>>>>......<.<<<<.......>>>>>...<<<<<<......>>>>>>...
U88846.1 1.00 .CUCUCUCGAUGCACUCUCCGCUCAUCACGGACACUUCCACCUAAGUUCUCGAUCUUUAAAAUCG UUAG.CUCGCCAGUUaGCGAGGUCUGUCCCCACACGACAGAU.AAU.CG.GGUGCAACUCCCGCCCCUUUUCCGAGGGUCAUCGGAACCA
................................................................ .....................<<<<<<<.......>>>>>>>......<.<<<<.......>>>>>...<<<<<<......>>>>>>...
U88847.1 1.00 .UGCACUCUCCGCUCAUCACGGACACUUCCACCUAAGUUCUCGAUCUUUAAAAUCG UUAG.CUCGCCAGUUaGCGAGGUCUGUCCCCACACGACAGAU.AAU.CG.GGUGCAACUCCCGCCCCUUUUCCGAGGGUCAUCGGAACCA
....................................................... .....................<<<<<<<.......>>>>>>>......<.<<<<.......>>>>>...<<<<<<......>>>>>>...
U88848.1 1.00 .CACCGCUCCCCCCGCAUCGACCUGCAUAAUAACUGUAUCAGGAACUCUCUCGAUGCACUCUCCGCUCAUCACGGACACUUCCACCUAAGUUCUCGAUCUUUAAAAUCG UUAG.CUCGCCAGUUaGCGAGGUCUGUCCCCACACGACAGAU.AAU.CG.GGUGCAACUCCCGCCCCUUUUCCGAGGGUCAUCGGAACCA
............................................................................................................ .....................<<<<<<<.......>>>>>>>......<.<<<<.......>>>>>...<<<<<<......>>>>>>...
U88849.1 1.00 .UUCAAUUCAAUACCUUGACUCGCCCAAACUCCUCAUCUCCAUCACCGCUCAACCCACCGCUCCCCCCGCAUCGACCUGCAUAAUAACUGUAUCAGGAACUCUCUCGAUGCACUCUCCGCUCAUCACGGACACUUCCACCUAAGUUCUCGAUCUUUAAAAUCG UUAG.CUCGCCAGUUaGCGAGGUCUGUCCCCACACGACAGAU.AAU.CG.GGUGCAACUCCCGCCCCUUUUCCGAGGGUCAUCGGAACCA
.................................................................................................................................................................. .....................<<<<<<<.......>>>>>>>......<.<<<<.......>>>>>...<<<<<<......>>>>>>...
U88850.1 1.00 .ACCCCCGGGUCAAAGAUUCAAUUCAAUACCUUGACUCGCCCAAACUCCUCAUCUCCAUCACCGCUCAACCCACCGCUCCCCCCGCAUCGACCUGCAUAAUAACUGUAUCAGGAACUCUCUCGAUGCACUCUCCGCUCAUCACGGACACUUCCACCUAAGUUCUCGAUCUUUAAAAUCG UUAG.CUCGCCAGUUaGCGAGGUCUGUCCCCACACGACAGAU.AAU.CG.GGUGCAACUCCCGCCCCUUUUCCGAGGGUCAUCGGAACCA
.................................................................................................................................................................................. .....................<<<<<<<.......>>>>>>>......<.<<<<.......>>>>>...<<<<<<......>>>>>>...
U91413.1 1.00 .UUUCCGGUACCAUCACUCUCCACUCUCCUCUGCUUCAGGCCUCUUCCUCCUGAAG UUAG.CUCGCCAGU-.GCGAGGCCUCUUCCUACACAAGAGGU.AUU.GG.GGUGCGACUCCCCCGUCUAUCCUGAACGUCAUCAGGACCA
...............................................<<<<<<.. .................................................................................>>>>>>...
V01418.1 1.00 .UUUAAAAUCG UUAG.CUCGCCAGUUaGCGAGGUCUGUCCCCACACGACAGAU.AAU.CG.GGUGCAACUCCCGCCCCUCUUCCGAGGGUCAUCGGAACCA
.......... .....................<<<<<<<.......>>>>>>>......<.<<<<.......>>>>>...<<<<<<......>>>>>>...
X54354.1 1.00 .ACUGACACCCCUAAACUCCUCAUCUACUCCACCGCCCCCUCCUACUCAACCUCCGCGACAUGUACACUGACCAUCCGCGGAAAGGUGAGGCUUCAUUCACCACUCCUCUCCUCCUCAUCCUCCUGAGCUUCGGCUCA UUAG.CUCGCCAGU-.GCGAGGCUCGUUCCCACACAACAAGU.AAU.GGuGGUGCAACUC-CCCCGUCCUCCCGAACGUCAUCGGGACCA
......................................................................................................................................... .....................................................................<<<<<<......>>>>>>...
Y16104.1 1.00 .CUUUCUGAGGCUGGAAUCCUACUUCCCGUUUGACUCACGUUAAAGUCACG UAAUuGAGGACAGUU.-CCUCUCCCUCUAGCACACAGAGGUC.AAAcUG.GGUGCAACUCCCCCCCC--UUCCGUGGGU-AACGGAAACCA
.................................................. .....................................................................<<<<<<......>>>>>>... .