Seq ID Score (bits) Sequence
AF035198.1 0.00 .GACAATCTCAGGGACCCTGACCCTCCATTCCCCCCTTCTTCAAGCCTCTTCTTGAGGC UCAG.GUCGCCAGU-.GCGACACCCGUUCCCACACAACGGGC.AUU.GG.GGUGCAACUCCCCCGUCUAUCCUGAACGUCAUCAGGACCA
.......................................................... ...............................................<<.<<.......>>>>...........................
AF035199.1 0.00 .TTCCATTGCTCAAACCACAGCTCCAACCCTAGCCACCTGTTCCGTGACTATAACCGGAACTCTCACTCTTCACTCCCCCCTCCTTCAGGCAACCGCCTGAT CCAG.GUCGCCAGU-.GCGACACCCGUUCCCACACAACGGGC.AUU.GG.GGUGCAACUCCCCCGUCUAUCCUGGACGUCACCAGGACCA
..................................................................................................... ...............................................<<.<<.......>>>>...........................
AF035201.1 0.00 .CTTCGTAGG CCAG.GUCGCCAGU-.GCGACACCCGUUCCCACACAACGGGC.ACU.GG.GGUGCAACUCCCCCGUCUAUCCUGGACGUCACCAGGACCA
......... ...............................................<<.<<.......>>>>...........................
AF035402.1 0.00 .TTGTCTTCTCCTCTTCTCCAAGCCTCTTAAACCCCTGCATCCTCCATCTCCTATGG UAAUuGUGGACAGUU.-CCACUCCCUUUAGCACACAAAGGUCcAAU.CG.GGUGCGACUCCCCCCCCUCCUGU--GGGCUACAGGAACCA
........................................................ ..........................................................................................
AF035633.1 0.00 .AGCTCCTCGTCTTTTCCCCTGCCCCCGCCAAGGCAACCTCCGTCACCCTCGCCTCTCCTCAGATCAGCGGCGAGGTTCTCTGCTCTTCCCAACTCCTCCAAGCCCTCTAGTGCACCCAGAACTTGGTTCTGCGCGGCCAATGCGATAATTGGTAGTGTTTTCGGCTCCACTTAAATCGAAGCCCG UAAUuGAGUCCAGU-.GACUCUCCCUCUAGCACACAGAGGUC.AAAcCG.GGUGCAAC-C-CCCCCUCCCCCCGUAGGUUAACGGGACCA
......................................................................................................................................................................................... ..........................................................................................
AF035635.1 0.00 .CCCCGAAACTCGTCCTCTCCGTCACCGCCCAACCAACCCCCCCCACCGCATCGACCTGCATAATAACTGTATCAGGAATCTTATCGATGCACTCTCCGCTAATCACGGACACTTCCACCTGAGTTCTCGATCTCTAAAATCG UCAG.CUCGCCAGUUaGCGAGGCCUGUUCCCACACAACAGGU.AAU.CG.GGUGCAACUCCCGCCCCUACUCCGAGGGUCAUCGGAACCA
.............................................................................................................................................. ...............................................<<.<<.......>>>>...........................
AF035636.1 0.00 .CCGAAACTCGTCCTCTCCGTCACCGCCCAACCAACCCCCCCCACCGCATCGACCTGCATAATAACTGTATCAGGAATCTTATCGATGCACTCTCCGCTAATCACGGACACCTCCACCTGAGTTCTCGATCTCTAAAATCG UCAG.CUCGCCAGUUaGCGAGGCCUGUUCCCACACAACAGGU.AAU.CG.GGUGCAACUCCCGCCCCUACUCCGAGGGUCAUCGGAACCA
............................................................................................................................................ ...............................................<<.<<.......>>>>...........................
D00637.1 0.00 .TCTCCTCTCCTTCAGGCCACAGCCTGAT UCAG.GUCGCCAGU-.GCGACACCCGUUCCCACACAACGGGC.AUU.GG.GGUGCAACUCCCCCGUCCAUCCUGGACGUCACCAGGACCA
............................ ...............................................<<.<<.......>>>>...........................
J04374.1 0.00 .TGCTCCCAGCTCTCCCTCCAAAACCCCAACCGCCACTATCCAAATCCATGGCAAGCTCCGCTTGTCCTCCCCCCTCCTCCAAGCCAATTAACTCTCTCTCCCTCAGCCACCACCTCGCTCCTCCCCCATCTCCTATGG UAAUuGCGGACAGUU.-CCGCUCCCUCUAGCACACAGAGGUC.CAUuUG.GGUGCGACUCCCCCCCC--UCCCGUGGGUCAACGGGAACCA
.......................................................................................................................................... .......................................................................................... .
M15284.1 0.00 .AGGYYAAAATCAG YAAU.GAAGGCAGUC.-CUUCUCCCUUUAGCACACAAAGGUC.AAA.UG.GGUGCGACUC-CCCCCCUUUUCCGAGGGUCAUCGGAAACC
............. ..........................................................................................
M58309.1 0.00 UUAG.CUCGCCAGUUaGCGAGGUCUGUCCCCACACGACAGAU.AAU.CG.GGUGCAACUCCCGCCCCUCUUCCGAGGGUCAUCGGAACCA
...............................................<<.<<.......>>>>...........................
S97776.1 0.00 .AGTCACG UAAUuGAGGACAGUU.-CCUCUCCCUCUAGCACACAGAGGUC.AAAcUG.GGUGCAACUCCCCCCCC--UUCCGUGGGU-AACGGAAACCA
....... .......................................................................................... .
U88845.1 0.00 .CTGCATAATAACTGTATCAGGAACTCTCTCGATGCACTCTCCGCTCATCACGGACACTTCCACCTAAGTTCTCGATCTTTAAAATCG UUAG.CUCGCCAGUUaGCGAGGUCUGUCCCCACACGACAGAU.AAU.CG.GGUGCAACUCCCGCCCCUUUUCCGAGGGUCAUCGGAACCA
....................................................................................... ...............................................<<.<<.......>>>>...........................
U88846.1 0.00 .CTCTCTCGATGCACTCTCCGCTCATCACGGACACTTCCACCTAAGTTCTCGATCTTTAAAATCG UUAG.CUCGCCAGUUaGCGAGGUCUGUCCCCACACGACAGAU.AAU.CG.GGUGCAACUCCCGCCCCUUUUCCGAGGGUCAUCGGAACCA
................................................................ ...............................................<<.<<.......>>>>...........................
U88847.1 0.00 .TGCACTCTCCGCTCATCACGGACACTTCCACCTAAGTTCTCGATCTTTAAAATCG UUAG.CUCGCCAGUUaGCGAGGUCUGUCCCCACACGACAGAU.AAU.CG.GGUGCAACUCCCGCCCCUUUUCCGAGGGUCAUCGGAACCA
....................................................... ...............................................<<.<<.......>>>>...........................
U88848.1 0.00 .CACCGCTCCCCCCGCATCGACCTGCATAATAACTGTATCAGGAACTCTCTCGATGCACTCTCCGCTCATCACGGACACTTCCACCTAAGTTCTCGATCTTTAAAATCG UUAG.CUCGCCAGUUaGCGAGGUCUGUCCCCACACGACAGAU.AAU.CG.GGUGCAACUCCCGCCCCUUUUCCGAGGGUCAUCGGAACCA
............................................................................................................ ...............................................<<.<<.......>>>>...........................
U88849.1 0.00 .TTCAATTCAATACCTTGACTCGCCCAAACTCCTCATCTCCATCACCGCTCAACCCACCGCTCCCCCCGCATCGACCTGCATAATAACTGTATCAGGAACTCTCTCGATGCACTCTCCGCTCATCACGGACACTTCCACCTAAGTTCTCGATCTTTAAAATCG UUAG.CUCGCCAGUUaGCGAGGUCUGUCCCCACACGACAGAU.AAU.CG.GGUGCAACUCCCGCCCCUUUUCCGAGGGUCAUCGGAACCA
.................................................................................................................................................................. ...............................................<<.<<.......>>>>...........................
U88850.1 0.00 .ACCCCCGGGTCAAAGATTCAATTCAATACCTTGACTCGCCCAAACTCCTCATCTCCATCACCGCTCAACCCACCGCTCCCCCCGCATCGACCTGCATAATAACTGTATCAGGAACTCTCTCGATGCACTCTCCGCTCATCACGGACACTTCCACCTAAGTTCTCGATCTTTAAAATCG UUAG.CUCGCCAGUUaGCGAGGUCUGUCCCCACACGACAGAU.AAU.CG.GGUGCAACUCCCGCCCCUUUUCCGAGGGUCAUCGGAACCA
.................................................................................................................................................................................. ...............................................<<.<<.......>>>>...........................
U91413.1 0.00 .TTTCCGGTACCATCACTCTCCACTCTCCTCTGCTTCAGGCCTCTTCCTCCTGAAG UUAG.CUCGCCAGU-.GCGAGGCCUCUUCCUACACAAGAGGU.AUU.GG.GGUGCGACUCCCCCGUCUAUCCUGAACGUCAUCAGGACCA
....................................................... ...............................................<<.<<.......>>>>...........................
V01418.1 0.00 .TTTAAAATCG UUAG.CUCGCCAGUUaGCGAGGUCUGUCCCCACACGACAGAU.AAU.CG.GGUGCAACUCCCGCCCCUCUUCCGAGGGUCAUCGGAACCA
.......... ...............................................<<.<<.......>>>>...........................
X54354.1 0.00 .ACTGACACCCCTAAACTCCTCATCTACTCCACCGCCCCCTCCTACTCAACCTCCGCGACATGTACACTGACCATCCGCGGAAAGGTGAGGCTTCATTCACCACTCCTCTCCTCCTCATCCTCCTGAGCTTCGGCTCA UUAG.CUCGCCAGU-.GCGAGGCUCGUUCCCACACAACAAGU.AAU.GGuGGUGCAACUC-CCCCGUCCUCCCGAACGUCAUCGGGACCA
......................................................................................................................................... ..........................................................................................
Y16104.1 0.00 .CTTTCTGAGGCTGGAATCCTACTTCCCGTTTGACTCACGTTAAAGTCACG UAAUuGAGGACAGUU.-CCUCUCCCUCUAGCACACAGAGGUC.AAAcUG.GGUGCAACUCCCCCCCC--UUCCGUGGGU-AACGGAAACCA
.................................................. .......................................................................................... .