Seq ID Score (bits) Sequence
AB090330.1 0.00 .UACAACUAUAAAUUUUUAUUAUAUAAUUACAGUUAAAAUUUAGUAAGUUAAAAUUUAA UACUUAUCAAGAG.CGGUGGAGGGA..CUGG.CCCUAUGAAGCC-.CAGCAACCUAUA.UGAAaa.................................................UAUAUAA-GGUGCUAAAUC..CUGCAGCA-....UAA-.....-GCUGAGAGAUGAGGAUGUGUCUAGGAAUUUUAAAACCUAAGGGAACUAUCCUUUAGGUUUUUUAUUUUUAAAGUCUCUCAGAAAUUAAAUAUUUGUAGUACAUCAUAUAAAAAUUAAGGGGGCUUUAAAAUGCAUAUAAAAGAAUUGUUUAAUCAAA
.......................................................... ...............................................................<..................................................<........>>............<................................... >.....<.........................................>.............................................................................................
AE007554.1 0.00 .UGGCUAAUAAGCUAGCAUAGAAAAAUAUUCUUGACAAUUAAAAUAAUAGAACAUAUAAUAAUCAUAUUAAACAAGUUCGAAAACUAAAUAAUUGU UUCUUAUCAAGAG.UGACGGAGGGA..UAGG.CCCUAUGAAGUC-.CGGCAACAUCCA.AUUAu..................................................UUUGGAGAUGUGCUAAUUC..CUACAGGU-....UUA-.....UCCUGAGAGAUGAGAAUGUUUUUAAAACUGCUUCUUAUUUUUUAAUGGAUAAGAAGCAGUUUU
.............................................................<................................. ........................>.................................................................................................................................................... ...............................................
AE007573.1 0.00 .UUUCCUUAAAAUCCAUGAAUGCACCUCCAAUCAUUUUAUAACAUCCAAUUUAUAAAGUAAUUUUCCUAAAGUCUUAACUGGAUAAAUGAAAUAUCUAUAAUAAAUAUAUGUAUUUAUUAUUGUAAAAUUACUGUAUUGACAUUUUUUAAUUUAACUAAUAUAAUAAAAACAAAUUUAAUGUAAAA AUCUUAUCAAGAG.UGGUGGAGGGA..CUGG.CCCUUUGAAACC-.CGGCAACCAGUA.UAUUuuuuaa.............................................UAUAUGU-GGUGCUAAAUC..CUGCAGCA-....-AA-.....CGCUGAUAGAUGAGAAUAAUCGCGAAUGUAA
......................................................................................................................................................................................... ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>.....>........................................ ...............
AE007608.1 0.00 .AAACUUAAUAUU UCCUUAUCAAGAG.AAACGGAGGGA..CUGG.CCCAAUGAUGUUU.CAGCAACCAAGG.UUUU...................................................AUACUUAUGGUGCUAAUUC..CAGCAGGA-....-UAUu....UUCUGAAAGAUGAGGAGCGACUAUUUAAACAUUUUUAUUUUGUUAAUAGAUCCUCUUCUUUUAAAAGAAGAGGAUUUUAUUUUGUUAAUAAUAGAACCAACUUAUUAUUAUUUGGUUUUAUUCUAUUAAAAGUGGUG
............ ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>.....>........................................ .........................................................................................................................
AE007614.1 0.00 .AUAUAUGAAUUGCGUAUAAAAAAGACUAAAUUCAUAUUGACAUUUAAAUAUAUACUAACUAUAAUAUUAAAUAAAGAAAUUAAUAAAUUAGUG CACUUAUCAAGAG.AGGUGGAGGGA..CCGG.CCCUGUGAAGCC-.CAGCAACCUGUA.UAUGuuaau..............................................UAUACAA-GGUGCUAAUUC..CUGCAGCGC....-UA-.....-GCUGAGAGAUGAGAAUAUAAAUCGAGCUUUUAGAGCCAGAGUUUAUUCUCUGGCUCUUAUUAUUUUUUAAUCUAAUGGGAAAAGGUGAAUGACAUGAUAGAAAUAAAAAAUGUUUCUAAAUA
............................................................................................. ..................................................................<...............................................<........>>............<................................... >....<<.......................................>>...........................................................
AE007691.1 0.00 .UAAAAAGAAUUGUACUAUAGUAUAAUUACUAUUUAGUGAUAAAAUUUCAUAUUAU UUCUUAUCAAGA-.AGGUGGAGGGA..CUGG.CCCUAUGAAGCC-.UGACAACCGGCA.----...................................................AAUGUAC-GGUGUUAAUUC..CUGCAAAACu...UAUUug...UUUUGAAAGAUAAGAAAACAGCUUAUUAAUUAAUGAGUAUGUUAAUAAUCCGUUUUUCUUAUUGGAAAAUGGAUUUUUUUUAUAUAUUAAAAUUUAAACUAGGACGGUGAAAAAAAUGCCUAUAAAAAUACCUGAUAAUCUUCCAGCAGCAAAAACUUUAA
....................................................... ...<.......>.......<..<<..............<....>..>....<<<....................................................................>>>.>.....>........................................ .................................................................................................................................................
AE007776.1 0.00 .AUUGAAAAUCUAUUGACAGAUUUAUAUAAAAUGAUAUAAUUUAAUCAUAAAGUAAAAUAAACGAUUCAUAUAUGAAUAGUAGGAAAAAUUGAAUAUAUUUAUGAUAAG GUCUUAUCAAGAG.AGGUGGAGGGA..CUGG.CCCUAUGAAACC-.CAACAACCAGCA.UUUUuuaauu.............................................AGAUGUAUGGUGUUAAUUC..CUGCAAAG-....UUAA.....UUUUGAGAGAUAAGAGGAUUAUAAAAUUUUAGAAAGCUAAAAUCCUCUUCAACUAAGAAGAGGAUUUAAUUUUAUAUAUUUUUAGGUUUAGAUAUUGAAGUUAAAAUA
............................................................................................................ ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>.....>........................................ ............................................................................................
AE007783.1 0.00 .AAUCCAUGUUCCUCCACCAUAAAAGACACACAAGUGUCUUUUUUUAAGUUUAUAUUGACUAAGAUUGUUAUAAAGUGUAUUAUUUAGUGUGUAAUAUAAUUGAAUGGAAA CUCUUAUCAAGAG.AGGUGGAGGGAa.AGGG.CCCGUUGAAACC-.CGGCAACCGAUG.UAUUaauuuaag...........................................UACAUAAUGGUGCCAAUUC..CUGCAGAA-....UUA-.....UUCUGCAAGAUAAGAGAGAGAAUGUUAAGUCUCUUCUUAUUGAGGAGACUUUUAUUUUUAUAUUGUAGGAGGAAGUGGAUAUAAUGAGAAAGUUAUUUACAUCUGA
.............................................................................................................. ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>.....>........................................ ..........................................................................................
AE010547.1 0.00 .AUAUUGACAAAAUUUAUAAAAAAUGUUAAAAUUAUCUUGGAAAU AAACCAUCAAGAG.AGAUUGAGGGA..CAGG.CCCGUUGAGAUCU.CAGCAACCUACG.UAA-...................................................AAUGUGU-GGUGCUAAUUC..CUGAUAGAUg...GAAAaga..UUAUAAUACAUCUCUCUAUCUGGAAUUGGAUAGAGUUUUUUUAUUUUAAUAUUUUGUUAAUUUUUUAAGGAGGGAAAAAUGAAAAAGUUUACAUACUUUACAUCAGAAUUUGUUUCACCAGGACAUCCAGAUAAAAUUUCAGAUCAAAUAUCAGAUGCAAUUUUAGAUGCUU
............................................ ...................<..<<...............<....>.>....<<<....................................................................>>>.>.....>........................................ ............................................................................................................................................................
AE010577.1 0.00 .AUCAAAAAUAGAUUACUUAAAAUAAA UAACCAUCCAGAG.AAACGGAGGGA..CUGG.CCCAAUGAUGUUU.CAGCAACCUACU.UA--...................................................AAUGUGU-GGUGCUAAUUC..CAGAGAGA-....-UG-.....GAGAGGAAAAUUGAAACAAGAACUAAUCCAUACUCUAUAAGGUAUGGAUUUUUUAAUUAAGUAAGAAUUUAUUAUAGAAAGUAGGGAUAUAAAUGAUUACACUUGAAAAUGUAAAUAAAAUUUAUUCCAAUAACUUGCAUGCUGUAAAAGAUGUUAAUUUAAAAGUUAAUGAAGGAGAUAUCUUUGGAAU
.......................... ...................................................................................................................................<....<<................................... >....<...............................................>.>.....>................................................................................................................
AE012834.1 0.00 .GCAGCGUCUUGUAAAAUAGUAUCAUCUGUCGUAGAUUCCUGAAACUUGAACGUUCUUUUUCAGAUUUCGAG CUAUCAUCCAGAA.AGGCGGAGGGA..CUGG.CCCUGCGAAGCCU.UGGCAACCUUCA.UUCCa..................................................CAUGAGC-GGUGCCAAAUC..CAUCCCGGAg...GAAAu....CCGGGAAAGAUGAUGUAUGCAUUCCUGCUGAUUUCAUACCUCACUUGAUGCUUCCCGCACAUACCUCCUGACCCCGACCGCGCACUACGGAUCGAGCGCUUCAACCUUGUACCAUUUGCCAUGAGUGAGGAUAACACCUUCCGGU
....................................................................... .<.<.......>>......<...<..............<....>..>.....<........................................................................................>...............>............... .................................................................................................................................
AE013020.1 0.00 .GCCAAAAGAAAAAUUUGUAGCCUUUUAAAGUGCGCUUUUUAGCGCGCUUUUUUGUUUUUACAAAAAUAUUUGACAUACCUUGUAAAGUGUGAUAUAGUAGACAGCAGAAAAUUUAAUAACACG CUCUUAUCAAGAG.AGGUGGAGGGAa.AGAG.CCCGAUGAAACC-.CGGCAACCUGUC.CUUUua.................................................AGGAUAA-GGUGCCAAUUC..UCUCAGAAGa...UUUUuuc..UUCUGAAAGAUGAGGGUAUGCCUCUUCUUUUAGAAGGGGUUUUAUUUUGCUCUUAAGGAGGGAAGAAGAUGCGUAGACUCUUUACUUCUGAGU
........................................................................................................................... ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>.....>........................................ .............................................................................
AE013132.1 0.00 .AUAAAGAGUAAAUAAUUUUAACAAUUUAAUACUUUAAAAU CUCUUAUCAAGAG.AGGUGGAGGGA..CUGG.CCCGAUGAAACC-.CGGCAACCAGCC.UU--...................................................AGGGCAU-GGUGCCAAUUC..CUGCAGCG-....GUUU.....CGCUGAAAGAUGAGAGAUUCUUGUAGUCUCUUCUUUUAGCGAA
..........<....>.....<.................. ..................>.......................................................................................................................................................... ...........................
AE013162.1 0.00 .CAAUC CUCUUAUCAAGAG.UGGUGGAGGGA..CUGG.CCCGAUGAAACC-.CGGCAACCGGCA.CGUA...................................................AGUGCUU-GGUGCCAAUUC..CUGCAGGUUggggUUACcca..GCCUGAGAGAUGAGAGGAGAGGCCGAGUAAUUGUGAUUACUAGGCCCUCUUCUCAUUGAAGAGGGCCUAAGAAUUUUUCUGGAGGUGCAAAAUGAGGGUAAAGAUUGGGUUGAUGGGACUUGGAACUGUUGGGACAGGAGUAUUUAAAAUAGUUAAUUCUAGAGGGAGAUAUAUCAAGGA
..... .................................................................................................................................<<................<....>.>......<........... .............................>.>....................................................................................................................................
AE015937.1 0.00 .UAAAUAAAAAG CUCUUAUCGAGAG.AGGUGGAGGGAa.AGGG.CCCUAUGAAACC-.CGGCAACCAAUA.UUUUuaga...............................................AGUAUUAAGGUGCCAAUUC..CUGCAGAA-....-AG-.....UUCUGCAAGAUAAGAGGGCUGGCAAAUAAAAAGCAAGUCUCUUCUUAUCGGAAGAGGCUUUAUUUUUAUAUAAGAGCUACACAAUAGGAGGUAAAAGGAUGAGGAAAUUAUUUACAUCUGAAUCAGUUACAGAAGGGCAUCCAGAUAAGAUUUGCGAUCAAAUUUCCGACGCAGUGCUUGAUGCCAUACUUGAAAGGGACCCAAA
........... ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>.....>........................................ .............................................................................................................................................................................................
AE015940.1 0.00 .UUAAUUGUUAAAUUUUUGGGGAGAAUUUUUGGGGACGGUUAAUGAAAAUUUGCCAUAACAAUGGUAAACUUUCAUUAACCGUCCCUUCUAUUUUCUUCUAUUUUGAAAAAUAACUAUCCAAUAUUUUUUUAAUUACUUGACUUUUGAAAUAAUUAAAUAUAUAAUAUGCUUUAAAUUGAAUAAAUAAUUUAAAAU AUCUUAUCAAGAG.CGGUUGAGGGA..CUGG.CCCUAUGAAACC-.CAGCAACCUAUA.CACAa..................................................AGUAUAAAGGUGCUAACUC..CAGCAGGA-....-AAUu....UCCUGAAAGAUAAGAAAAGUU
................................................................................................................................................................................................... ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>.....>........................................ .....
AE015944.1 0.00 .UUUUACGUGUUGCCUGUACAGUUAUAAUGUGAUAAAAUAAACUUUGAAUUUAAUAAGGA UUCUUAUCAAGAG.AGGCGGAGGGA..CUGG.CCCUAUGAAACC-.CGGCAACCAAAA.AUAAu..................................................AAUUUUAAGGUGCCAAUUC..CAGCAGGU-....GAAA.....-CCUGACAGAUAAGACGUAGAGGAAUAUAAACUUCUUGCUUUUAUCUGCAAGAAGUUUUUUUAUAAUUAAAGUUGGGAGGAUAUAAAUAUAUGAAAAGUAAAUUACAAGGUAAUGCUAUGGCAUUAUUGCCAUUAUUAGUGUUCAUAUUAUUGUAUA
........................................................... ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>.....>........................................ .............................................................................................................................................
AE016744.1 0.00 .CUUGCUUACGUUUAAUCUUUUAAUCUUUGGAAAUCAUAUCAAUUCAUUGAACUUACAGAAAAAGUUAGUUAAAAUUAAAAUAAUUAGAAAAUUUAGACUAUUAGGACGAAAUGCAUUUCUACAUCACAAUACAAUUAAAUUACCUA ACCUUAUUUUGAG.AAGCAGAGGGAu.UUGG.CCCGUAGAAGCUU.CAGCAACCGACU.UUA-...................................................AAUAGCACGGUGCUAAUAC..CAACGAGC-....-AA-.....-CUCGAAUGAUAAGUACGAUAAGUGCCUUUACAUCAUUUGAGUAAGGCACUUUUUUAGUUGAAGGAGGUA
................................................................................<.......>......<..<<............<....>.>....<..................... ......................>.>.......>............................................................................................................................................ ......................................................
AE016745.1 0.00 .GCUUAUGCGUAGAGAGGAAGAGAUAAAAAGAAUCUACGCAUUUCAGUCAGUUACUUAUUUGUUAGAAAAUUUAAAAUAAUUAUUGACGAAACAUUAGUACGAUGGUAGGAUUAAUACAAAUUAAAUAUGCUUUAA CUCUUAUCGAGAG.AGGUGGAGGGA..UGUG.CCCUAAGAAGCC-.CGGCAACCGUCU.AAA-...................................................AUAGAAAUGGUGCCAAUUC..ACAUAAAGUa...UAA-.....CUUUAGAAGAUGAGAGAAAGAACAUUUCAACAAAUGCUUUCUCAAAUUUUCUAAAAAUUGAGAAAGCAUUUUUAAUUUGAU
....................................................................................................................................... ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>.....>........................................ .................................................................
AE016750.1 0.00 .UAAAGUUGAUGGUUAUUUUUGGACUUGCAGUAACGAUUUUUAUCUUAGCAUCAAUAAGUGUGGCUAUUUUCGAAAAAUACUUUACUAUUAUUGAAAAUAUGUAAACUAUUAUUAAAAUAUUUAAAAUAAUAAGUGUUGACGUUAUUGCAAAUAUCUUGUAACGUUAAACACAAUUCAAU AACUUAUCAAGAG.AAGUGGAGGGA..CUGG.CCCAAAGAAGCUU.CGGCAACA---U.UGU-...................................................AUC---A-UGUGCCAAUUC..CAGUAACCGa...GAA-.....GGUUAGAAGAUAAGGUUAAACACGACGUUAACUGAGA
.........................................................................<.......>......<..................<....>.......<<............................................>>........>.. ............................................................................................................................................................................. .....................
AF027868.1 0.00 .AAAAAGAGAUUGACAUCAAUCUGAGUCUUCUUUAUGAUAAACGUAUUCUUCAUUCUGAAAAUUACAUACUCAAUAU UUUCUAUCCAGAG.AGGUGGAGGGA..CUGG.CCCUAUGAAACCU.CGGCAACA----u----...................................................UAU-----UGUGCCAAUUC..CAGCAAGCG....CUA-.....GCUUGAAAGAUAGGAAAGCAAGGUUUAUACCGGCGUCUGCCUGUAACAGAGCGCGCCUAUAUAUGAAUCUCUUUCCAUCUUCGGAAAGAGAUUUUUUUUAUGAAAAAUACGAUGAAAAGGAUGUUUUGCAGCAUGACGGU
............................................................................ .......<........>......<....<<..............<.....>.>.............................................................<.......................................................>.. .>.....>....................................................................................................................
AF269983.1 0.00 .UUACAGAAAAAGUUAGUUAAGAUUAAAAUAAUUAGAAAAUUUAGACUAUUCGAGACGAAAUGCAUAUCUAUAUCACAAUACAAUUAAAUUACCUA ACCUUAUUUUGAG.AAGCUGAGGGAu.UUGG.CCCAUAGAAGCUU.CAGCAACCGACU.UUA-...................................................AAUAGCACGGUGCUAAUAC..CAACGAGC-....-AA-.....-CUCGAAUGAUAAGUACGAUAAGUGCCUUUACAUCAUUUGAGUAAGGCACUUUUUUAGUUGAAGGAGGUAGGAACUAUUAUGACGAAUUACACGGUUAAUACAUUAGAACUAGGUGAGUUU
............................<.......>......<..<<.............<....>.>....<..................... ......................>.>.......>............................................................................................................................................ .........................................................................................................
AF270301.1 0.00 .CAUACGAUAAUUUAUGUAAGCCCUUACAUUUAGAUAGUAUAACAUACAGAUUGAAUUUAUCCACUUUAAAAUAGAAAUAGUGACAAUGUAUAAAAUUGACAACAUACUUUGAAUUAGAUAUUAUUAAGUUUAACGGAUU CUCUUAUCCUGAG.UGGUGGAGGGAc.AUGGaCCCAAUGAAACC-.CAGCAACCUCUU.UAUU...................................................UAAAGAAAGGUGCCAAACCguUUGCAGACAa...AUAUg....GUCUGAACGAUAAGAGCGAAUGGACGUUUAAGAGCCUUCUCUCUAUCUAUA
........................................................................................................................................... ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>....>......................................... ...................................
AJ000974.1 0.00 .AAUCCUAUAAAAAAAGUCGGGUUGACUUAUGUUAGAAUUGUGCUAAAAUUUACUACAAAUCUAAA AACUUAUCAAGAG.CGGCUGAGGGA..CUGG.ACCUAUGAAGCC-.CGGCAACCUGCA.UAG-...................................................UUUGUAA-GGUGCUACUUC..CAGCAAAAU....GAAUucca.UUUUGAAAGAUAAGGGCUGCAUGCUGUUCCUGUCUUUCUUUCCGCCGGAUUGAAAGUUUUUUAUUUUAAGAGGUAAAAAGGCUAUCUGUAUAUCAGCAGCCGCGAAUCACAUUACAUGGGAAAAGACAACCGGCAGAAAGCUACUGUUUGU
................................................................. ...<.......>.......<..<<..............<....>..>....<<<....................................................................>>>.>.....>........................................ .......................................................................................................................................
AJ002571.1 0.00 .UCAUGUAAAUAAAAAUUUCAAAUUCUAUGUUGACAAUGAAUUUGAAUUACUGUUAAGAUUACCAACAAAUGAUUCAACUUUUCAAAAAAUUAAUAACAUUUU CUCUUAUCGAGAGuUGGGCGAGGGA..UUGG.CCUUUUGACCCCAaCAGCAACCGACC.GUAAuaccauugugaaauggggcgcacugcuuuucgcgccgagacugaugucucaUAAGGCACGGUGCUAAUUC..CAUCAGA--....UUGU.....GUCUGAGAGAUGAGAGAGGCAGUGUUUUACGUAGAAAAGCCUCUUUCUCUCAUGGGAAAGAGGCUUUUUGUUGUGAGAAAACCUCUUAGCAGCCUGUAUCCGCGGGUGAAAGAG
...............................................................................................<...... .>......<...<.......................>....<<<..................................>>>.......>.................................................................................... ..................................................................................................
AL591973.1 0.00 .AGUUUUCUAAGAAGCCGGAAUAUCAAGAAGUAGAAGCAUCUAAAUAACAAGCGUAGACUGGGUUUUCUGCCCGGUCUAUUUUUUUAUAAAAUAAUUUUUGGGAUUUCAGUUUUCUCUUCUUGACAUCUGCUUUGUUUCAGUGUAUCUUUAAUUCACAGUAAACUUAUAGGAAUAAUAGUAUUACGUU UUCUUAUCAAGAG.UGGUGGAGGGAa.UCGG.CCCAGUGAAACC-.CAGCAGCGGAGC.GC--...................................................AAGUUC--UAUGCUAAUUCc.GAUCAGAAG....UAAUa....UUCUGGCAGAUAAGUAGUAGCUUUCAAUG
........................................................................................................................................................................................... ..<<.......>>......<..<<..............<....>..>....<........................................................................>.>.....>........................................ .............
AL591974.1 0.00 .AGCAUUGACAAAUUAAGCUAAUAUGCGUAUAUUUUUAACUAACAGGUUUUUCUAAAAUAUUUU CUCUUAUCGAGAG.CGGCAGAGGGA..CUGG.CCCGAUGAAGCC-.CGGCAACCUAAC.UUUAuuuaagcau..........................................AAAGUGAAGGUGCUAAUUC..CAGCAAAAUggu.GUAUuccg.UUUUGGUAGAUAAGAGGAGCUGGAUAUGUUCGACUUUCCACUUCUCUAUUCUAAAAUAGAGAAGUUUUUUUAUUGCUUUCAUGAAUAAAUCUGGAUAAUCACACAACAUACUAGGGAGGAAAAAAGAUGAAAAAAUUAACAAAAGGGUUAGGA
............................................................... ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>.....>........................................ .........................................................................................................................................
AL591976.1 0.00 .AGAUGCUGAAAUUGAAAUCGAAGUUAUCGCAGAAGCAUAAAUAUUCAGAAAUAAAUUUGACAACCACGAGAAAUAAACGAUAUAAUAAGAACCAAUUACAUAGU AACUUAUCAAGAA.AGGUGGAGGGUu.CUGG.CCCCGUGAAGCCU.UGGCAACCGGAU.UU--...................................................---UUCACGGUGCCAAAUC..CAGCAGG--....UAA-.....CACUGACAGAUAAGGCACGCGAAUCAGGUAAAUUACUCUUUCCCUUAAAAGCUGUCUUUUAAGGGAAAGUUUUUUUAUACAUAAAAAUAAUAAGAAUUGAGGCGAAGAAAAU
..................<<.......>>........<<...........<....>.>....<......................>.>................ ............................................................................................................................................................................. ................................................................................................
AL591980.1 0.00 .AGUUUUUAGCUGCAAGUGGUAUGAUGAUUUCAAUCCAAUUUAAGUGAUUAAAAAAACUAAAUAAAUUG CUCUUAUAAUGAG.UGGUAGAGGGA..CUGG.CCCGUUGAAACC-.CGGCAACCUUUC.AAUAcg.................................................UUGAAAA-GGUGCUAAAUC..CUGCGAAGUg...UGAUg....CUUCGAGAGAUAAGAGAGACUUAAAAAGUUUCAGUGUAUUUGUGUAUCGAAACUUCCAAACCUCUCUAGUUCUCUAGGGAGGUUUUUUAUUGGCAAAAAAUCGAGAGGAUAAGGUGAUAGGUAUGGUAAAGGCGAUUAGUUCAAACUU
..................<..<.........................<<................... .....................>>.>........>........................................................................................................................................... ....................................................................................................................................
AL591983.1 0.00 .UAACUUACAAAUAAAUUAAUAUAAGUGAGAAAGUUAUUGACAAAGUCUACUAGAAAAGGUAAUAUGAAAAAACAAGAAACGUCACUAUAGUCACAAAUGAAGUGAUUUAAUAAUAUGUAGAA AUCUUAUCCAGAG.UGGUGGAGGGA..AAUG.CCCUAUGAAGCC-.CAGCAACCUAAA.CAAUaauucauuaug........................................UGUUUAA-GGUGCUAAGUC..AUGCAGAACaac.UAAUug...UUCUGAAAGAUGAGAAGGAAGUUAGUCCAUUUGAAAAAAUGCUGCCUUUCUGCUCAUCAGCAGAAAGGCUUUUUUUGUAUAUCAGAAUGUAGAA
.......................................................................................................................... ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>.....>........................................ ..............................................................................
AL596163.1 0.00 .UUUCAGUGUAUCUUUAAUUCACAGUAAACUUAUAGGAAUAAUAGUAUUACAAU UUCUUAUCCAGAG.UGGUGGAGGGAa.UCGG.CCCAGUGAAACC-.CGGCAGCGGAGC.GC--...................................................AAGUUC--UAUGCUAAUUCc.GAUCAGAAG....UAAUa....UUCUGGCAGAUAAGUAGUAGCUUUUAAUGAGGCGCUUCGAUUCUGACCAAAAAACAGAGGAAGCGUUAUUUUUAGCGCUUAAAGAGGGGAGUUUUUGUUAGAUGAAGAAAUUUUUAUUAGUAGCGGUUAUCUCGGUUUUUGCCUUGGUGUUAACGGCUUGCGG
..................................................... ..<<.......>>......<..<<..............<....>..>....<........................................................................>.>.....>........................................ ...................................................................................................................................................
AL596164.1 0.00 .AAAAUGCGUAUAUUUUUAACUAACAGGUUUUUCUAAAAUAUUUU CUCUUAUCGAGAG.CGGCAGAGGGA..CUGG.CCCGAUGAAGCC-.CGGCAACCUAAC.UUUAuuuaagcgu..........................................AAAGUGAAGGUGCUAAUUC..CAGCAAAAUggu.GUAUuccg.UUUUGGUAGAUAAGAGGAGCUGGAUAUGUUCGACUUUCCACUUCUCUAUUCUAAAUAGAGAAGUUUUUUUAUUGCUUUCAUGAAUAAAUCUGGAUAAAUAAUCAACAUACUAGGGAGGAAAAAAAGAUGAGAAAAUUAACAAAAGGGUUAGGAAUUUUACUUGCAUCAAGCC
............................................ ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>.....>........................................ ............................................................................................................................................................
AL596165.1 0.00 .CGUAAUAUAUAACUUAAUUUAAUAGUAUU UUCUUAUCACGAA.AGGUGGAGGGA..CUGG.CCCUUUGAAGCCU.UAGCAACCGGAA.UUU-...................................................AUUUUCACGGUGCUAAUUC..CAGCAGUA-....-UA-.....UUCUGAAAGAUAAGUCGGAAAUCCAAGUUUAGGAAACUCUAUCCUCUCUGGCGGCUUAUAUACUGCUAGGGAGGUUUUUUGAUGGAAAUUACUGAUAAAUACAUAUUAAAGAGGAGUGGAUUUUAUGAGUAAUGAGUAUAAAUUCGAAACAAUUCAAGUACACGGCGGACAUACACCGGACGGAGAU
............................. ...................................................................................................................<.......>.......<..................................<....>. .......................................................>...................................................................................................................
AL596166.1 0.00 .CCCCGCAAGAAGUGCUUUCCAAGUAGCCAAGUUACCGCUUGACGCUGACAUUGAAAUCGAAGUUAUCGCAGAAGCAUAAAUAUUCAGAAAUAAAUUUGACAAUCACGAGAAGUAAACGAUAUAAUAAGAACCAAUUACAUAGU AACUUAUCAAGAA.AGGUGGAGGGUu.CUGG.CCCAGUGAAGCCU.UGGCAACCGGAC.UU--...................................................---UUCACGGUGCCAAAUC..CAGCAGU--....-AU-.....CACUGACAGAUAAGGCACGCGAAACAGGUAAAUCACUCUUUCCCUUAAAAGCUGUCUUUUGGGGGAAAGUUUU
.........................................................<<.......>>........<<...........<....>.>....<<....................>>.>................ ............................................................................................................................................................................. .........................................................
AL596169.1 0.00 .UUUAGAUAAGUAAAACAUCUUUUUUAUCCAUCUAUCAUACCACAGGAUGGAAAUAAUGAUAAGUGAAAAAUAAAGGAAGGCACUUUUUUACUGUUUUUUGCAAAUGGAAAUCAAGACAAAACCGAAUUUUUAUUGCAUAUAGCCUCAGUUUAUGGUAUUCUAUCUUAGAAUUAAAAUUUAU CUCUUAUCCAGAG.CGGUAGAGGGA..CUGA.CCCUUUGAAGCC-.CAGCAACCUACA.CAUAu..................................................AAGUGAAAGGUGCUAAUCUg.UUGCAGGAG....UAAUauc..UCCUGAACGAUGAGAGCAAAGGUAUAAUUAUAGCC
.......................................................................................................<<..................>.<<..................................>>.>................ ............................................................................................................................................................................. ...................
AL596170.1 0.00 .AGGGAUUUUUGGAAAUCAAAUAUUUUAUUUUGUGGUCGCUGGAAUCCUUUUGCUAGGCUGUUUAUUAUUAGCUUUGGGAGGACGGAAGGAAGCACAUUGAAAGAAAAUAAAAAUUUAAUGAUUGACAGUUUUUAGUUGCAAGUGGUAUGAUGAUUUCAAUCCAAUUUAAGUGAUUAAAAAAACUAAAUAAAUUA CUCUUAUUAUGAG.UGGUAGAGGGA..CUGG.CCCGUUGAAACC-.CAGCAACCUUUC.AAUUcg.................................................UUGAAAA-GGUGCUAAAUC..CUGCGAAGUg...UGAUg....CUUCGAGAGAUAAGAGAGACUU
................................................................................................................................................<..<.........................<<................... .....................>>.>........>........................................................................................................................................... ......
AL596172.1 0.00 .AUUGACAAAGUGUGACGGAAAAGGUAAUAUGAAAAAACAAGAAACGUCACUAUAGUCACAAAUGAAGUGAUAUAAUAAUAUGUAGAA AUCUUAUCCAGAG.UGGUGGAGGGA..AAUG.CCCUGUGAAACC-.CAGCAACCUAAA.CAAUaauucauuaug........................................UGUUUAA-GGUGCUAAGUC..AUGCAGAACaac.GAUUug...UUCUGAAAGAUGAGAAGGAAGUUAGCCCAUUUGAAAAAAUGCUGCCUUUCUGCUCAUUAGCAGGAAGGCUUUUUUGUAUAUCAGAAUGUAGAAAAGGUGAUAGAGAUGAUUACGUUACAGAACGUCGUA
....................................................................................... ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>.....>........................................ .................................................................................................................
AL939119.1 0.00 .AC CGCUCAUCCAGAG.GGGCAGAGGGAu.ACGG.CCCGAUGAAGCCC.CGGCAACCCUCC.AGUCgguucuugucacacggacguggcgaggcucccgg.................CUAGGGAAGGUGCCAAAUC..CGUCUCACGgcg.AGAUgcgucGUGAGGAAGAUGAGGAGAAAGGGCCUCGCCUCCAUGGCUGUGCAGACUGCCGAAACCUCCACGAACCCCACCGACGCCGCCGUCGACCUCGGCCCCGCCACCGCGCUGAGCUGCCGGGAGUGCGGCCACAGGGUUCCGCUCGGACCGGUCUUCGCCUGCGAAGAGUGUUUCGGCCCCCUCGAGAUCGCCUACGACUUCUCGGACUACGACGCCG
.. ..................................................................<..........>......<.....................................<....>........<.<.................................. ...........>.>.......>................................................................................................................................................................................
AP001510.1 0.00 .CCCUUUGAAGUUCGGAAUACGUCCUUUUAACGGAAACGGGAAACGGCCAACCUUUUUUUCGGUCAUUUCCUGCCACAUUUGUUCCCGUAUCGCUUGUUUAUCUGUCAAUCUAUUCCCCUCCAUUUUUUUCGUUCAUAUGGAUUGCUUUAUUCCCAUCAUUCUGAUAUGAUUACUUAAACUUCAUAUU UUCUUAUCCAGAG.UGGUGGAGGGA..CUGG.CCCUGUGAAGCC-.CGGCAACCUCUU.UUUU...................................................UAAAGAA-GGUGCCAAUUC..CAGCAGAACa...UGAUg....UUCUGAAAGAUAAGAAGCGAACGGAUCGC
.........................................................................................................................<..........>......<..<<....................>....<<................ .....................>>.>........>........................................................................................................................................... .............
AP001511.1 0.00 .GCAAUCAAGAUCAAGUGAACAGUGAUAAUAAAAA GACUUAUCGAGAG.AGGCAGAGGGA..CUGA.CCCGAUGAUGCC-.CGGCAACCCGUU.UGUUagccaag............................................CAAACGAAGGUGCUAAUUU..CAGCAGAAUg...AUUUca...UUCUGGAAGAUAAGCGAAGGCGAAAACCUUUCCUUAUCGGAAAGGUUUUUUUGUUAGAGAGCCAAGUUUUUAUAAAAAUGAGGAGAGGGCAUACGAAAGGGGAAAUAAUCAGAUGAUUAAAGUUGGUGUGAUCGGAUUUGGCACCGUUGGGCAAGGUGUUGUCGAGAGUCUAGUUCAAUUGG
.................................. ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>.....>........................................ ......................................................................................................................................................................
AP001512.1 0.00 .AAAAUAGUGUCUCGUA UUCUUAUCCAGAG.AGGUGGAGGGA..ACGG.CCCGAAGAAACCU.CAGCAACCAGCC.ACGAucc................................................UGUGGUCAGGUGCUAAUUC..CUGCAAGCAu...UAUUu....GCUUGAGAGAUAAGAGGAAGCGAGUGAGAUCCAACACCUACUUCUUCUUAAUCUUACAUGACGAGAAGGUAGGUGUUUUUUUACACAAUCAGAAAAGAUCGAACUUUUCAGAUAGUUUAAGAAAAAUGAAGGCUUUCGCAACUUGGCGACGAGCUGAUUUUUCCAAUAGAUGGAUAGGAGGAGCAACCAUGAAUCGUAAA
................ ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>.....>........................................ ........................................................................................................................................................................................
AP001518.1 0.00 .AAGAAAA CUCUUAUCAUGAG.AGGUGGAGGGA..CUGG.CCCGAUGAAGCC-.CAGCAACCGCCA.AGCAgcaaaucgc..........................................UUGGAAAAGGUGCUAAUUC..CUGCAAAGC....-GAUg....CUUUGAGAGAUGAGAGAAGGGAAGACGUAAAACAUUCCUUUCUGCUCAUGGCGGAAAGGUUUUUUUGUUCUAUUAUGCAGUUUGAUUCACGGAAUUGUACUUUCUUACGAUAAUGAUUUGCGUGCUCCUUGAGACGAAAUUUGCGAGAGUGAGAGUUUUUGCUCUCGUACUGACUUUCGUUAAAUUGGUAACGCGUAGACGAACUGAUA
....... ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>.....>........................................ .................................................................................................................................................................................................
AP003193.2 0.00 .CAAAGGGGGCAGACUGUAAAUCUGUUGUCGGACGACUUCGAAGGUUCGAAUCCUUCUUCCACCACCAGAAAGAGACACUAUUAAUUAAGUGUCUCUUUAUUAAAAUAAUAUCUUAAUAAAAUAGAAUAAUUAGUAUUUAUAUA CUCUUAUCCAGAG.AGGUGGAGGGAaaAAGG.CCCUAUGAAACC-.CGGCAACCAGUG.AGAA...................................................AUCACUACGGUGCCAAUUC..CGGUAAAG-....AAAUu....CUUUACAAGAUGAGAGAAGAUAAAUUUAGUGUAUAACUAAAAUCUCUUCUUAAAUCUUUAAAGGUUUGAGAAG
............................................................................................................................................... ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>.....>........................................ .........................................................
AP004595.1 0.00 .UAUAUUUUACGAUUGGUUAUGUUGAGCUUGAUUUACAACCUUUCACUACGAACAAAAAUCAGCUUUUCUAAAUUAUAAUAAAUUUCACUAUUGAUUAUUUUAAUGUUAUCAGUUAGAAUAUUAUAAAGUUAAUUUUUUAAAAAUUUAAUAUAGUUA GACUUAUCAAGAG.AGAUGGAGGGA..UUGG.CCCGAUGAAGUCU.CAGCAACCAGCC.UAGA...................................................UAAGGUAUGGUGCUAAUUC..CAAUAGGC-....UUACaa...GCCUUAAAGAUAAGAAGAGCUAUGUAUUUUAACCCUUCUUCUUACUUUUAGAAGAGGGGU
...................................................................................................................<..<<................>................... ........................>........>........................................................................................................................................... ............................................
AP004596.1 0.00 .UUUGAAAUCUUUAUGAUCUUUCGUUCAGCGUAGUACUGCCCGGCUAGAAGCACAAACUUUUUAUUUUCAAAAAAGUCUUGACACUAUAUUCAAUAUCUUAUAAAAUUUCUAUUAAUUAAAUAUGACAA UUCUUAUCCAGAG.AGGUGGAGGGA..CUGG.CCCAAGGAAGCCU.CGGCAACAGACU.UAUUugau...............................................UAAGUAC-UGUGCCAAUUC..CAGUAGCG-....UAAU.....UGCUAGAAGAUGAGAAGAGUAUAUAGUACGGUUUCCUGUACCCUCUUCUUACUUGUAGAAGGGGGUUUUUACUUUUCCCUAUUCUCUG
................................................................................................................................ ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>.....>........................................ ........................................................................
AP004597.1 0.00 .GUAGACAAAUUAUUAUACAAGUUGCAAGAAUGCGCAAUUAAAUCAUAGUAGACAAAUCGGAUUAAUGUGGUUAUAAUGUAUUAUAUGAAAA UACUUAUCAAGAG.AGGUGGAGGGA..CUGG.CCCGCUGAAACCU.CAGCAACAGAAC.GCA-...................................................UCUGUC--UGUGCUAAAUC..CUGCAAGC-....-AAUa....GCUUGAAAGAUAAGUUGAGGUUAUCGUAAUAUCCAAGUUCUCUCUUCUUAUCUUUAUCAUGUUUUUUAAUAGAAGGGAUGGAUUUAUAUAUGAGCAUACGGAAUGAAGAUGAAACGGAACAAAGA
........................................................................................... ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>.....>........................................ .............................................................................................................
AP004600.1 0.00 .UUAACGAUCCAUAUUUAUUAAAUCUGAUUAUUAGUAUAACACAUUAAAAUAAAUAGUCCAUACUAUAUUAAAAUUUAUUUUAUGCAAUAUAUUUUUUGAUGUGACAAGGCUUAAAUUAGUUGACAGACAACUCACCUUUCGUUAAUCUUAACCAUGAACGGAUA CUCUUAUUCAGAGuUGGUGGAGGGA..CAGA.CCCGAUGAAGCC-.CAGCAACCAUCA.CUACu..................................................GGUGAAAAGGUGCUAAUCUg.AUGCAAGGA....UAAUaguu.CCUUGAACAAUAAGAGCGAAAGGCCAUAAUUCUUCCUUUCCUCAUGUUAUGA
.................................................................................................................................................................... ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>...>.......................................... ....................................
AP004601.1 0.00 .AAUAUCAACCAGAAUUAUUCUCAAAUGUGACGUAAAAAAAUUAAUUGACAGUCCUAUAGGCGCAUGCUAAGAUAGGUACACUGAAUUAAUAAAAAAUAACCAUUAACAAUAUGAUAU CUCUUAUCUAGAG.CGGUGGAGGGA..CUGG.CCCUUUGAAACCG.CGGCAACCUUCA.UAAUua.................................................AAUGAAA-GGUGCCAAUUC..CUGCAG---....-AAA.....--AUGAAAGAUGAGAGAACGUCAGACGAUAUACGAUAAAUACGUACGUCUUUCUGUUCUCUUACAGAAAGGCGUUUUUAUUUUGACGAAUUAUGGGGAA
.....................................................<.......>......<...<...........<....>>.......................... ........>.................................................................................................................................................................... ...................................................................................
AP004602.1 0.00 .AUUGACAUUUCUUACAUAUUGAAUUAUUAUUCUACCAACAACUUUAUAUACGUUU UUCUUAUCAUGAG.AGGCGGAGGGAa.AUGG.CCCAACGAAACCU.CGGCAACAGGUU.CUUAu..................................................UAGAAUACUGUGCCAAUUC..CAUCAAGC-....AAAUu....GCUUGAAAGAUAAGAGUAGAAUAAUUUAUUAGCUUUAAAACUCUAUUCUUAUUACGGAAUAGAGUUUUUUGUUACAUAGAAUGGCUCUAUAAUAUUUGUUGGGGUAAAAGAAAAAUAAAAAACACGCAAUCUCCUAUUUUUGUUAUCAUUGUUUAAACCAC
....................................................... ..<<.......>>......<..<<..............<....>..>....<<......................................................................>>.>.....>........................................ .................................................................................................................................................
AP004603.1 0.00 .AACUUGUAUUAUUAUCGUGGCAACAAACUAAAUAAUGAAAU AUCUUAUCCUGAG.AGGUGGAGGGAa.AUGG.CCCAAAGAAGCCU.CGGCAACAGGUU.CUAGc..................................................UUGAAUACUGUGCCAAAUC..CAUCAAGUAu...UCUAu....GCUUGGUAGAUAAGAGAAGUCGGCGACAGAGCUCUUUUCUUAUCUUUAUGAAAAGGGUUUUUUAAUUACUAACGAUAGAUAAUGGGGGAUGAAAAUGAAGUAUGGUUUCUGGUUGCCGAUUUUUGGAGGGUGGUUGCGUAAUGUAGAAGAUGAACAGAUGCCUCCUACUUUUGAA
......................................... ..<<.......>>......<..<<..............<....>..>....<<......................................................................>>.>.....>........................................ ...............................................................................................................................................................
AP004604.1 0.00 .UCCCUUUUUAGAUAUAUACAUAUAUAUGUAAUUGGAUGCUUAUUCUGUCUUAAAUGAGUUUUCAACUAGUAUCCAAAUCCCUUAUUGACAAUUAGUAAAAACCGUAAUAGUAUGAUAAUUAAAAUUUAAUACGCUAAUAU CUCUUAUUGAGAG.UGGCUGAGGGA..CUGG.CCCUGUGACGCC-.CGGCAACCGUUC.AUCGuaauuccagug........................................AUGAAUA-GGUGCUAAAUC..CUGCAAAAUac..GGACagua.UUUUGAGAAAUAAGAGAGGUGAUGAAUGACUUACGUAGUGUAAUGUUAUGCCUCUCGAUUUCACAUCGGGAGGCAU
............................................................................................................................................ ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>.....>........................................ ............................................................
AP004822.1 0.00 .CUGAAAAUCAUUGAACAGAUAUUUAAACUUAGGUAAACUGUUAGUAAUCAGAAAAUUCUGAUAUACAAAUCGUCUAUGUUAAGAUUGGGAAUCGUGUAUACGUAAGCGAUUUGGCUAACGCAUGACAAUGAUAACAACAUUUUAAAUGAUAAAGUAAUUCAUCACUGAAUCUCAACUAACACAUAACAAUUUCAUAU UUCUUAUUGUGAG.AAGUUGAGGGAc.UUGG.CCCUGUGAUACUU.CAGCAACCGACU.UU--...................................................AUAG-CACGGUGCUAAAAC..CAACGAG--....UUA-.....-CUCGAAUGAUAAGUAUAA
................................................................................................................................<.......>.........<<..........<....>.>....<<......................... .....................>>.>.................................................................................................................................................... ...
AP004824.1 0.00 .UUUUACUAAGGUGUUAGGAUUAAUACAAAUUAAAUGAUGCGUAAA CUCUUAUCGAGAG.UGGUGGAGGGA..UGUG.CCCUACGAAGCC-.CGGCAACCGUCU.UAU-...................................................AUAGAAAUGGUGCCAAUUC..ACAUAAAGUu...UUAA.....CUUUUGAAGAUGAGAGAAACAAUACUACUAUUGCUUUCUCAAUUUUUCUAUCGAUAUUGAGAAAGCAUUUUUUAUUUUAUUAAGCAACACAGGGAGGAAUCAACGUGAUUGAAUUAAAAGAAGUUGUUAAAGAAUAUCGGACUAAAAAUAAAGAAGUCCUUGCUGUAGAUC
............................................. ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>.....>........................................ ...........................................................................................................................................................
AP004828.1 0.00 .UUUUACUGUAAAUUUAUUUGUGAAAAAUUGACAUUAAUUCAUUAAUUAGGUACUAUUAUUUUUAACGGAUU CUCUUAUCCUGAG.UGGUGGAGGGAc.AUGGaCCCAAUGAAACC-.CAGCAACCUCUU.UUUUuau................................................AAAAGAAAGGUGCCAAACCguUUGCAGAC-....AAAUag...GUCUGAACGAUAAGAGCGAAUGGACGUAUUAGGCCUUCUCUCUAUAUUAAUAGUUAGAAGGUCUUUUUUAUUUAGCUCACAGAGAGAGAAUUUUCGUAAUAUAAAUUUAAAGGAGCAAACUAUGUUAAAUAACAAACGAUUAUUU
....................................................................... ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>....>......................................... .................................................................................................................................
AP004829.1 0.00 .GUAAGUGUGUCUAUCGUGUUCAUUUUUAUUGCAUUAAUGCUUAAAUGGUGGCUUUUACUUGUUAUUAGCAUUAUUGUUUUGAUUAUUAUUACAGUAGCAAUGAUUGUUUAUGAAAAAUAUUAUACGACUCCUGAUUAAUUUAUGAUUGACGUACUAAGGAUUAUCUUGUAACGUAAACGUAAAUAAGCAU CACUUAUCUAGAG.AGGUGGAGGGA..CUGG.CCCUAUGAAGCCU.CGGCAACA----.UCU-...................................................CGA---A-UGUGCCAAUUC..CAGUAACCG....UAAU.....GGUUUGAAGAUAAGCAGGUAAAGCAC
..................................................................................<.......>..........<......................>......<...........................................>.............. ............................................................................................................................................................................. ..........
L42943.1 0.00 .UUUAAAUGUAAGCCUUUACAUUUAAUUAGUAUAACACAUUAACAUAAUUAAUCUACAAUAUUUUACUGUAAAUUUAUUUGUGAAAAAUUGACAUUAAUUCAUUAAUUAGGUACUAUUAUUUUUAACGGAUU CUCUUAUCCUGAG.UGGUGGAGGGAc.AUGGaCCCAAUGAAACC-.CAGCAACCUCUU.UUUUau.................................................AAAAGAAAGGUGCCAAACCguUUGCAGAC-....AAAUag...GUCUGAACGAUAAGAGCGAAUGGACGUAUUAGGCCUUCUCUCUAUAUUAAUAGUUAGAAGGUCUUUUUUAUUUAGCUCACAGAGA
................................................................................................................................... ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>....>......................................... .....................................................................
U36379.1 0.00 AUCCU-----GAG.UGGUGGAGGGAc.AUGGaCCCAAUGAAACC-.CAGCAACCUCUU.UUUUau.................................................AAAAGAAAGGUGCCAAACCguUUGCAGAC-....AAAUag...GUCUGAACGAUAAGAG.CGAAUGGACGUAUUAGGCCUUCUCUCUAUAUUAAUAGUUAGAAGGUCUUUUUUAUUUAGCUCACAGAGAGAGAAUUUUCGUAAUAUAAAUUUAAAGGAGCAAACUAUGUUAAAUAACAAACGAUUAUUUACUUCAGAGUCUGUUACAGAAGGACACCCAGAUAAAAUCGCUGACCAA
...................<..<<..............<....>..>....<<<....................................................................>>>.>....>......................................... ..................................................................................................................................................................................
U52812.1 0.00 .CAUAUGAAACCUUCCUUUAUCGUUUUUUGUGUUUUGCUAAUUGUGAAUUAGUAUAACAUAUAUUUUCAAAUAGUCUAUACUAUUUAUUGUUUUUUGUGUGUGCAUUUCCAUUGUUUUCCCUCAAUAUAGGUGCCUAUUUCUUCUGAAUCAUAUUGACAUUGCAAACCCUUUUACGAUAAGAUAUUUCAUUGAGCGGAUA CUCUUAUCCCGAGcUGGCGGAGGGA..CAGG.CCCUAUGAAGCC-.CAGCAACCGGUU.UCUCuguuauuuauuauguucaauugagugag.......................ACAACCAAGGUGCUAACCUg.UUGCAAGGUu...GUAUgauu.CCUUGAGCGAUAAGAGU
....................................................................................................................................................................................................... ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>...>.......................................... .
Z99109.2 0.00 .AGAUAUCUUUUGGCACUUCCUGACACGAAAAUUUCAUAUCCG UUCUUAUCAAGAG.AAGCAGAGGGA..CUGG.CCCGACGAAGCUU.CAGCAACCGGUG.UAAUggcgaucagcc........................................AUGACCAAGGUGCUAAAUC..CAGCAAGCUc...GAACa....GCUUGGAAGAUAAGAAGAGACAAAAUCACUGACAAAGUCUUCUUCUUAAGAGGACUUUUUUUAUUUCUCUUUUUUCCUUGCUGAUGUGAAUAAAGGAGGCAGACAAUGGGACUUUUAGAAGAUUUGCAAAGACAGGUGUUAAUCGGUGACGGCGCCAUGGGGACGCUCCUCUAC
.......................................... ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>.....>........................................ ..............................................................................................................................................................
Z99110.2 0.00 .GUUUUUCGGUGCCAUAAAAACAUUCCUCCAGGACAUCACUAUACUUUCUUGCAUUUUCAAUUAUUGUACCAUGAAUUAUUAGAAAUUUCUCUCUUUAAACGGUUCGGCACACGAAGAAAAAAGUGUUGAAAUAAACUGUGAAUUGCGCUAAUAUAAAACAAUCAGAAAAUUGAAAUCGAUAU UUCUUAUCGUGAG.AGGUGGAGGGA..CUGG.CCCUUAGAAACCU.CAGCAACCGGCU.UGUUuugcauuugcaa.......................................AGCGCCAAGGUGCUAAAUC..CAGCAAGCGu...UUUUuau..GCUUGGAAGAUAAGAAGAAGCGUUAAACCCCUUC
..............................................................................................................................<<.......................>......<....................... ...................>...>..................................................................................................................................................... ..................
Z99111.2 0.00 .GGCUUCGGUGAAUAUGGCGAGGGCUACGUCAGAGUCGGACUUUUAACAAGUGAAGAAAGACUUAAGGAAGCCGCUUAUCGAAUUGGCAAACUGAACCUGUUUACCCAAAAAAGCAUUGACAAGACCUUAUAACGAUGGGAUAAUUCAAAAUAAUUUAUAAAAUCUAUAUU UUCUUAUCAAGAGcAGGCAGAGGGA..CGAG.CCCGAUGAAGCC-.CGGCAACCGACU.UAU-...................................................AAAG-CACGGUGCUAAUUC..UUGCAGC--....UAGC.....GGCUGAGAGAUAAGAUUCGGACGAGAAACGAAACCUCUUUAGACGC
.....................................................................................................<.......>............................<....>......<................... ..................>.......................................................................................................................................................... ..............................
Z99119.2 0.00 .UUAUCGUUUUUUGUGUUUUGCUAAUUGUGAAUUAGUAUAACAUAUAUUUUCAAAUAGUCUAUACUAUUUAUUGUUUUUUGUGUGUGCAUUUCCAUUGUUUUCCCUCAAUAUAGGUGCCUAUUUCUUCUGAAUCAUAUUGACAUUGCAAACCCUUUUACGAUAAGAUAUUUCAUUGAGCGGAUA CUCUUAUCCCGAGcUGGCGGAGGGA..CAGG.CCCUAUGAAGCC-.CAGCAACCGGUU.UCUCuguuauuuauuauguucaacugagugag.......................ACAACCAAGGUGCUAACCUg.UUGCAAGGUu...GUAUgauu.CCUUGAGCGAUAAGAGUGAAAGGCACAAAGACC
....................................................................................................................................................................................... ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>...>.......................................... .................
Z99120.2 0.00 .CAUUCGCCGUGCUAUUCUACAUUAAGAAUUUCCGGACGAAAAAGACUAUAUAUUU CUCUUAUCAAGAG.AGGUGGAGGGA..AGUG.CCCUAUGAAGCC-.CGGCAACCAUCA.ACACu..................................................GUUGAAAUGGUGCCAAUUC..ACACGAAGCg...UUCAg....CUUUGAAAGAUGAGAGAAAGGCAUUUUAUAUAAGCCUUUCUGCUCAAGUGUGCAGAAAGGCUUUUCUUUUGCAGAAAAAACCGGAAGAUUUCUUAGAAUAGUGUUAAGGCAGGUGAUUGCUUUGAUCAAUCUUCAGGAUGUUUCAAAAGUUUACAAGUCGA
....................................................... ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>.....>........................................ .................................................................................................................................................
Z99123.2 0.00 .GCUAUCGUGCUUGAUAUGGUUUUAUAUAACGAUGAAGAUGAAAGUAUUUUCUAAAAAGCAUUGACAAUUGAUCCAAAAGUAAUAAUAUUAAGAUAAUUGAAAUCUGAAUAUGAAGUUGU ACCUUAUCAAGAG.AGGUGGAGGGA..CUGG.CCCUAUGAUACC-.CGGCAACCGCUG.UUUCa..................................................AACAGAAUGGUGCUAAAUC..CUUAAGAACa...UUGCg....UUCUUGCAGAUGAGGCGGAGAUUUGAUCGUUCAAGCUCUUCCUUACACAAAGGAAGAGCUUUUUACAUGCUUAAUAUUUCAGAAAAGAGGCGAAUAA
....................................................................................................................... ..<<.......>>......<..<<..............<....>..>....<<<....................................................................>>>.>.....>........................................ .................................................................................