Seq ID Score (bits) Sequence
AY355187.1 0.00 GGAUUGGGUGAUGAAUUAGAAGAAGUUAUUGUCGAGAAAACGAAACAGACACUAGCUUCAGUAUCAUCAGGACCAAAACACACCCA.GAGUGUCCCCAUAUUGACAGCUAAUGAAACAGGUGCCACUAUGCCAACUAACCCUUCAGACAAUGUGGAA
<<.......<<<<........<<<<<<<.<<<<..............>>>>.>>>>>>>.....>>>>.................. ........<<......................>>.<<......>>........>>................
AY355195.1 0.00 GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACA.AAAAGUCCCCAUACUAACUGCAAACGAAACAGGGGCCACAAUGCCUGUUCUUCCAUCAGACAGCAUAGAAACCAGAACUACCUACAUGCACUUUAAUGGUUCAGAAACUGAUGUAGAAUGCUUUUUGGGUCGUGCAGCUUGUGUGCAUGUAACUGAAAUACAAAACAAAGAUGCUACUGGAAU
<<.......<<<<........<<.<<<<.<<<<..............>>>>.>>>>.>>.....>>>>.................. ........<<......................>>.<<......>>........>>.................................................................................................................................
AY355216.1 0.00 GGCUUGGGAGAAGAGCUUGAGGAAGUCAUUGUCGAGAAAACGAAACAGACAGUGGCUUCAAUUGCUUCUGGAUCUAAACACACCCA.AAGUGUACCAAUGCUAACAGCAAAUGAAACAGGAGCUAGCAUGCCCGUGGAGCCAUCAGAUAGUGUUGAGACUAGA
<<.......<<<<........<<<<<<<.<<<<..............>>>>.>>>>>>>.....>>>>.................. ........<<......................>>.<<......>>........>>......................
AY355218.1 0.00 GGUCUGGGUGAUGAACUGGAAGAAGUUAUUGUUGAGAAAACGAAACAGACACUAGCUUCAAUAUCAUCAGGACCUAAGCAUACCCA.GAGUGUUCCUACACUGACAGCCAAUGAAACAGGCGCCACCAUGCCAACCAACCCAUCAGAUAAUGUAGAAACUAGAACAACAUACAUGCACUUCAAUGGUUCUGAAACGGACAUUGAAAGUUUCUUGGG
<<.......<<<<........<<<<<<<.<<<<..............>>>>.>>>>>>>.....>>>>.................. ........<<......................>>.<<......>>........>>...........................................................................
AY355253.1 0.00 GGUUUGAAUGACGAGUUAGAGGAAGUCAUCGUCGAGAAAACGAAACAGACGUUGGCUUCAAUUUCAUCCGGGCCAAAAUACACUCA.AAGUGUUCCCACUCU
.........<<.<........<<<<<<<.<<<<..............>>>>.>>>>>>>.....>.>>.................. ................
AY355260.1 0.00 GGUCUUAAUGAUGAAUUAGAAGAGGUCAUUGUCGAGAAAACGAGACAGACAUUGGCCUCUGUUUCUUCUGGACCUAAACAUACACA.GAGUGUACCUACAUUAACUGCUAAUGAAACUGGAGCCACCAUGCCAACUCAACCUUCUGACAAUGUAGAGACCAGGACUACUUAUAUGCAUUUUAAUGGUUCAGAAACAGAUGUAGAGAGCUUCUUAGGUAGGGCGGCGU
<<.......<<.<........<<<<<<<.<<<<..............>>>>.>>>>>>>.....>.>>.................. ........<<......................>>.<<......>>........>>......................................................................................
AY355264.1 0.00 GGCCUCAAUGAUGAAUUAGAGGAAGUUAUUGUCGAGAAAACGAGACAGACUUUAGCUUCCGUUGCAUCAGGACCAAAACACACCCA.GAGCGUGCCUAUUUUAACAGCAAAUGAAACUGGUGCCACCAUGCCAACUCAACCAUCAGACAAUGUUGAGACUAGGACUACUUAUAUGCAUUUUAAUGGAUCUGAAACAGAUAUAGAAAGCUUUCUGGGUAGAGCUGCAUGUGUACAUAUGGUU
<<.......<<<<........<<<<<<<..<<<..............>>>..>>>>>>>.....>>>>.................. ........<<......................>>.<<......>>........>>....................................................................................................
AY355267.1 0.00 GGGUUGGGAGAUGAACUAGAGGAAGUCAUAGUCGAAAAAACGAAACAGACGUUGGCUUCAGUUGCAACAGGUUCAAAAUAUACCCA.AAAAGUGCCAUCAUUGUCAGCUAAUGAGACAGGAGCAACCAUGCCCACAGUACCAUCAGAUAAUAUAGAAACCAGAACUACAUAUAUGAAUUU
<<.......<.<<........<<<<<<<..<<<..............>>>..>>>>>>>.....>>.>.................. ........<<......................>>.<<......>>........>>.......................................
AY355273.1 0.00 GGUCUUAAUGAUGAAUUGGAGGAAGUCAUUGUUGAGAAAACGAAACAGACAUUGGCUUCUAUCACUUCUGGACCCAAACAUACUCA.AAGUGUCCCCACGUUAACAGCAAAUGAAACCGGUGCCACCAUGCCUACUCAACCAUCAGACAAUGUUGAGACAAGAACAACCUAUAUGCAUUUCAAUGGUUCAGAAACAGAUGUUGAAAACUUCCUAGGUAGAGCAGCAUGUGUACAUAUGGUAGAAAUAGUUAAUAAAAA
<<.......<<.<........<<<<<<<.<<<<..............>>>>.>>>>>>>.....>.>>.................. ........<<......................>>.<<......>>........>>.....................................................................................................................
K02121.1 0.00 .CUUAUACUUCCCCCAGAAACGACCGGCCAGGUCUACUUAUUAUCAUUCAUAAGUGCAUGUCCAGAUUUUAAGCUUAGGCUGAUGAAAGAUACUCAAACUAUCUCACAGACUGUUGCACUCACUGAA GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACAAAAAGUCCCCAUACUAACUGCAAACGAAACAGGGGCCACAAUGCCUGUUCUUCCAUCAGACAGCAUAGAAACCA
.............................................................................................................................. <<.......<<<<........<<.<<<<.<<<<..............>>>>.>>>>.>>.....>>>>.................. .......<<......................>>.<<......>>........>>....................
L05355.1 0.00 .CAUUCAUAAGUGCAUGUCCAGAUUUUAAGCUUAGGCUGAUGAAAGAUACUCAAACUAUCUCACAGACUGUUGCACUCACUGAA GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACAAAAAGUCCCCAUACUAACUGCAAACGAAACAGGGGCCACAAUGCCUGUUCUUCCAUCAGACAGCAUAGAAACCAGAACUACCUACAUGCACUUUAAUGGUUCAGAAACUGAUGUAGA
................................................................................... <<.......<<<<........<<.<<<<.<<<<..............>>>>.>>>>.>>.....>>>>.................. .......<<......................>>.<<......>>........>>...............................................................
X01087.1 0.00 .UCAAACUUCUCUUAUACUUCCCCCAGAAACGACCGGCCAGGUCUACUUAUUAUCAUUCAUAAGUGCAUGUCCAGAUUUUAAGCUUAGGCUGAUGAAAGAUACUCAAACUAUCUCACAGACUGUUGCACUCACUGAA GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACAAAAAGUCCCCAUACUAACUGCAAACGAAACAGGGGCCACAAUGCCUGUUCUUCCAUCAGACAGC
........................................................................................................................................ <<.......<<<<........<<.<<<<.<<<<..............>>>>.>>>>.>>.....>>>>.................. .......<<......................>>.<<......>>........>>..........