Seq ID Score (bits) Sequence
AY355187.1 108.93 GGAUUGGGUGAUGAAUUAGAAGAAGUUAUUGUCGAGAAAACGAAACAGACACUAGCUUCAGUAUCAUCAGGACCAAAACACACCCA
<<.<<.<<<<<..........<<<<<<<.<<<<..............>>>>.>>>>>>>....>>>>>.>>.>>..........._
AY355195.1 115.24 GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACA
<<.<<<<<<<<..........<<.<<<<<<<<<..............>>>>>>>>>.>>....>>>>>>>>.>>..........._
AY355216.1 98.22 GGCUUGGGAGAAGAGCUUGAGGAAGUCAUUGUCGAGAAAACGAAACAGACAGUGGCUUCAAUUGCUUCUGGAUCUAAACACACCCA
<<.<<<<<<<...........<<<<<<<<<<<<..............>>>>>>>>>>>>.....>>>>>>>.>>..........._
AY355218.1 103.14 GGUCUGGGUGAUGAACUGGAAGAAGUUAUUGUUGAGAAAACGAAACAGACACUAGCUUCAAUAUCAUCAGGACCUAAGCAUACCCA
<<<<<.<<<<<..........<<<<<<<.<<<<..............>>>>.>>>>>>>....>>>>>.>>>>>..........._
AY355253.1 103.62 GGUUUGAAUGACGAGUUAGAGGAAGUCAUCGUCGAGAAAACGAAACAGACGUUGGCUUCAAUUUCAUCCGGGCCAAAAUACACUCA
<<<<<<.<<<<..........<<<<<<<.<<<<..............>>>>.>>>>>>>....>>>>.>>>>>>..........._
AY355260.1 101.58 GGUCUUAAUGAUGAAUUAGAAGAGGUCAUUGUCGAGAAAACGAGACAGACAUUGGCCUCUGUUUCUUCUGGACCUAAACAUACACA
<<<<<..<.<<.........<<<<<<<<.<<<<..............>>>>.>>>>>>>>...>>.>..>>>>>..........._
AY355264.1 100.52 GGCCUCAAUGAUGAAUUAGAGGAAGUUAUUGUCGAGAAAACGAGACAGACUUUAGCUUCCGUUGCAUCAGGACCAAAACACACCCA
<<.<<..<<<..........<<<<<<<<..<<<..............>>>..>>>>>>>>....>>>..>>.>>..........._
AY355267.1 94.04 GGGUUGGGAGAUGAACUAGAGGAAGUCAUAGUCGAAAAAACGAAACAGACGUUGGCUUCAGUUGCAACAGGUUCAAAAUAUACCCA
<<<<<.<..<...........<<<<<<<..<<<..............>>>..>>>>>>>.....>..>.>>>>>..........._
AY355273.1 99.53 GGUCUUAAUGAUGAAUUGGAGGAAGUCAUUGUUGAGAAAACGAAACAGACAUUGGCUUCUAUCACUUCUGGACCCAAACAUACUCA
<<<<<..<.<..........<<<<<<<<.<<<<..............>>>>.>>>>>>>>....>.>..>>>>>..........._
K02121.1 115.24 GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACA
<<.<<<<<<<<..........<<.<<<<<<<<<..............>>>>>>>>>.>>....>>>>>>>>.>>..........._
L05355.1 115.24 GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACA
<<.<<<<<<<<..........<<.<<<<<<<<<..............>>>>>>>>>.>>....>>>>>>>>.>>..........._
X01087.1 115.24 GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACA
<<.<<<<<<<<..........<<.<<<<<<<<<..............>>>>>>>>>.>>....>>>>>>>>.>>..........._