Seq ID Score (bits) Sequence
AY355187.1 0.00 GGAUUGGGUGAUGAAUUAGAAGAAGUUAUUGUCGAGAAAACGAAACAGACACUAGCUUCAGUAUCAUCAGGACCAAAACACACCCA
.<<>.<.....<..>.....<<....<<.<<<...<....>.......>>>.>>.>>..<...>...................>>.
AY355195.1 0.00 GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACA
.<.........<..>......<....<<<<<<<..<....>..>....>>>>>>.>...<...>....................>.
AY355216.1 0.00 GGCUUGGGAGAAGAGCUUGAGGAAGUCAUUGUCGAGAAAACGAAACAGACAGUGGCUUCAAUUGCUUCUGGAUCUAAACACACCCA
.<...<..............<<....<<<<<<...<....>.......>>>>>>.>>...<.>.....<..>...........>>.
AY355218.1 0.00 GGUCUGGGUGAUGAACUGGAAGAAGUUAUUGUUGAGAAAACGAAACAGACACUAGCUUCAAUAUCAUCAGGACCUAAGCAUACCCA
.<...<.....<..>..<..<<....<<.<<<<..<....>..>....>>>.>>.>>..<...>.<........>..<>.>..>>.
AY355253.1 0.00 GGUUUGAAUGACGAGUUAGAGGAAGUCAUCGUCGAGAAAACGAAACAGACGUUGGCUUCAAUUUCAUCCGGGCCAAAAUACACUCA
.<...<.....<..>.....<<....<<.<<<...<....>.......>>>.>>.>>..<<.>>....<..>.....<>....>>.
AY355260.1 0.00 GGUCUUAAUGAUGAAUUAGAAGAGGUCAUUGUCGAGAAAACGAGACAGACAUUGGCCUCUGUUUCUUCUGGACCUAAACAUACACA
.<...<.....<..>..<...<....<<.<<<<..<....>..>....>>>.>>.>....<.>.....<..>........>..>>.
AY355264.1 0.00 GGCCUCAAUGAUGAAUUAGAGGAAGUUAUUGUCGAGAAAACGAGACAGACUUUAGCUUCCGUUGCAUCAGGACCAAAACACACCCA
.<.........<..>.....<<....<<..<<<..<....>..>....>>..>>.>>..<<.>>....................>.
AY355267.1 0.00 GGGUUGGGAGAUGAACUAGAGGAAGUCAUAGUCGAAAAAACGAAACAGACGUUGGCUUCAGUUGCAACAGGUUCAAAAUAUACCCA
.<<>.<.....<..>..<..<<....<<..<<................>>..>>.>>...<.>...<.<..>>....<>.>..>>.
AY355273.1 0.00 GGUCUUAAUGAUGAAUUGGAGGAAGUCAUUGUUGAGAAAACGAAACAGACAUUGGCUUCUAUCACUUCUGGACCCAAACAUACUCA
.<.........<..>..<..<<....<<.<<<<..<....>..>....>>>.>>.>>..<...>....<..>........>...>.
K02121.1 0.00 GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACA
.<.........<..>......<....<<<<<<<..<....>..>....>>>>>>.>...<...>....................>.
L05355.1 0.00 GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACA
.<.........<..>......<....<<<<<<<..<....>..>....>>>>>>.>...<...>....................>.
X01087.1 0.00 GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACA
.<.........<..>......<....<<<<<<<..<....>..>....>>>>>>.>...<...>....................>.