Seq ID Score (bits) Sequence
AY355187.1 0.00 GGAUUGGGUGAUGAAUUAGAAGAAGUUAUUGUCGAGAAAACGAAACAGACACUAGCUUCAGUAUCAUCAGGACCAAAACACACCCA
.....<.......................<.........................................>...........>..
AY355195.1 0.00 GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACA
...................................................<..........>.......................
AY355216.1 0.00 GGCUUGGGAGAAGAGCUUGAGGAAGUCAUUGUCGAGAAAACGAAACAGACAGUGGCUUCAAUUGCUUCUGGAUCUAAACACACCCA
.....<.......................<.....................<..........>........>...........>..
AY355218.1 0.00 GGUCUGGGUGAUGAACUGGAAGAAGUUAUUGUUGAGAAAACGAAACAGACACUAGCUUCAAUAUCAUCAGGACCUAAGCAUACCCA
.....<...........<...........<.........................................>..>........>..
AY355253.1 0.00 GGUUUGAAUGACGAGUUAGAGGAAGUCAUCGUCGAGAAAACGAAACAGACGUUGGCUUCAAUUUCAUCCGGGCCAAAAUACACUCA
.....<.......................<.........................................>...........>..
AY355260.1 0.00 GGUCUUAAUGAUGAAUUAGAAGAGGUCAUUGUCGAGAAAACGAGACAGACAUUGGCCUCUGUUUCUUCUGGACCUAAACAUACACA
.....<...........<...........<.........................................>..>........>..
AY355264.1 0.00 GGCCUCAAUGAUGAAUUAGAGGAAGUUAUUGUCGAGAAAACGAGACAGACUUUAGCUUCCGUUGCAUCAGGACCAAAACACACCCA
.............................<.........................................>..............
AY355267.1 0.00 GGGUUGGGAGAUGAACUAGAGGAAGUCAUAGUCGAAAAAACGAAACAGACGUUGGCUUCAGUUGCAACAGGUUCAAAAUAUACCCA
.....<.......................<.........................................>...........>..
AY355273.1 0.00 GGUCUUAAUGAUGAAUUGGAGGAAGUCAUUGUUGAGAAAACGAAACAGACAUUGGCUUCUAUCACUUCUGGACCCAAACAUACUCA
.................<...........<.........................................>..>...........
K02121.1 0.00 GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACA
...................................................<..........>.......................
L05355.1 0.00 GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACA
...................................................<..........>.......................
X01087.1 0.00 GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACA
...................................................<..........>.......................