Seq ID Score (bits) Sequence
AY355187.1 0.00 GGAUUGGGUGAUGAAUUAGAAGAAGUUAUUGUCGAGAAAACGAAACAGACACUAGCUUCAGUAUCAUCAGGACCAAAACACACCCA
<<.<<....<<<<........<<.<<<<.<<<<..............>>>>.>>>>.>>.....>>>>.>>.>>............
AY355195.1 0.00 GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACA
<<.<<....<<<<........<<.<<<<.<<<<..............>>>>.>>>>.>>.....>>>>.>>.>>............
AY355216.1 0.00 GGCUUGGGAGAAGAGCUUGAGGAAGUCAUUGUCGAGAAAACGAAACAGACAGUGGCUUCAAUUGCUUCUGGAUCUAAACACACCCA
<<.<<....<<<<........<<.<<<<.<<<<..............>>>>.>>>>.>>.....>>>>.>>.>>............
AY355218.1 0.00 GGUCUGGGUGAUGAACUGGAAGAAGUUAUUGUUGAGAAAACGAAACAGACACUAGCUUCAAUAUCAUCAGGACCUAAGCAUACCCA
<<.<<....<<<<........<<.<<<<.<<<<..............>>>>.>>>>.>>.....>>>>.>>.>>............
AY355253.1 0.00 GGUUUGAAUGACGAGUUAGAGGAAGUCAUCGUCGAGAAAACGAAACAGACGUUGGCUUCAAUUUCAUCCGGGCCAAAAUACACUCA
<<.<<....<<.<........<<.<<<<.<<<<..............>>>>.>>>>.>>.....>.>>.>>.>>............
AY355260.1 0.00 GGUCUUAAUGAUGAAUUAGAAGAGGUCAUUGUCGAGAAAACGAGACAGACAUUGGCCUCUGUUUCUUCUGGACCUAAACAUACACA
<<.<<....<<.<........<<.<<<<.<<<<..............>>>>.>>>>.>>.....>.>>.>>.>>............
AY355264.1 0.00 GGCCUCAAUGAUGAAUUAGAGGAAGUUAUUGUCGAGAAAACGAGACAGACUUUAGCUUCCGUUGCAUCAGGACCAAAACACACCCA
<<.<<....<<<<........<<.<<<<..<<<..............>>>..>>>>.>>.....>>>>.>>.>>............
AY355267.1 0.00 GGGUUGGGAGAUGAACUAGAGGAAGUCAUAGUCGAAAAAACGAAACAGACGUUGGCUUCAGUUGCAACAGGUUCAAAAUAUACCCA
<<.<<....<.<<........<<.<<<<..<<<..............>>>..>>>>.>>.....>>.>.>>.>>............
AY355273.1 0.00 GGUCUUAAUGAUGAAUUGGAGGAAGUCAUUGUUGAGAAAACGAAACAGACAUUGGCUUCUAUCACUUCUGGACCCAAACAUACUCA
<<.<<....<<.<........<<.<<<<.<<<<..............>>>>.>>>>.>>.....>.>>.>>.>>............
K02121.1 0.00 GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACA
<<.<<....<<<<........<<.<<<<.<<<<..............>>>>.>>>>.>>.....>>>>.>>.>>............
L05355.1 0.00 GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACA
<<.<<....<<<<........<<.<<<<.<<<<..............>>>>.>>>>.>>.....>>>>.>>.>>............
X01087.1 0.00 GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACA
<<.<<....<<<<........<<.<<<<.<<<<..............>>>>.>>>>.>>.....>>>>.>>.>>............