Seq ID Score (bits) Sequence
AY355187.1 1.00 GGAUUGGGUGAUGAAUUAGAAGAAGUUAUUGUCGAGAAAACGAAACAGACACUAGCUUCAGUAUCAUCAGGACCAAAACACACCCA.GAGUGUCCCCAUAUUGACAGCUAAUGAAACAGGUGCCACUAUGCCAACUAACCCUUCAGACAAUGUGGAA
<<.<<.<<<<<<<........<<<<<<<.<<<<..............>>>>.>>>>>>>..>>>>>>>.>>.>>............ .......................................................................
AY355195.1 1.00 GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACA.AAAAGUCCCCAUACUAACUGCAAACGAAACAGGGGCCACAAUGCCUGUUCUUCCAUCAGACAGCAUAGAAACCAGAACUACCUACAUGCACUUUAAUGGUUCAGAAACUGAUGUAGAAUGCUUUUUGGGUCGUGCAGCUUGUGUGCAUGUAACUGAAAUACAAAACAAAGAUGCUACUGGAAU
<<.<<<<<<<<.<<..........<<<<<<<<<..............>>>>>>>>>.....>>>>>>>>>>.>>............ ........................................................................................................................................................................................
AY355216.1 1.00 GGCUUGGGAGAAGAGCUUGAGGAAGUCAUUGUCGAGAAAACGAAACAGACAGUGGCUUCAAUUGCUUCUGGAUCUAAACACACCCA.AAGUGUACCAAUGCUAACAGCAAAUGAAACAGGAGCUAGCAUGCCCGUGGAGCCAUCAGAUAGUGUUGAGACUAGA
.....................<<<<<<<<<<<<..............>>>>>>>>>>>>........................... .............................................................................
AY355218.1 1.00 GGUCUGGGUGAUGAACUGGAAGAAGUUAUUGUUGAGAAAACGAAACAGACACUAGCUUCAAUAUCAUCAGGACCUAAGCAUACCCA.GAGUGUUCCUACACUGACAGCCAAUGAAACAGGCGCCACCAUGCCAACCAACCCAUCAGAUAAUGUAGAAACUAGAACAACAUACAUGCACUUCAAUGGUUCUGAAACGGACAUUGAAAGUUUCUUGGG
<<<<<.<<<<<<<........<<<<<<<.<<<<..............>>>>.>>>>>>>..>>>>>>>.>>>>>............ ..................................................................................................................................
AY355253.1 1.00 GGUUUGAAUGACGAGUUAGAGGAAGUCAUCGUCGAGAAAACGAAACAGACGUUGGCUUCAAUUUCAUCCGGGCCAAAAUACACUCA.AAGUGUUCCCACUCU
.....................<<<<<<<.<<<<..............>>>>.>>>>>>>........................... ................
AY355260.1 1.00 GGUCUUAAUGAUGAAUUAGAAGAGGUCAUUGUCGAGAAAACGAGACAGACAUUGGCCUCUGUUUCUUCUGGACCUAAACAUACACA.GAGUGUACCUACAUUAACUGCUAAUGAAACUGGAGCCACCAUGCCAACUCAACCUUCUGACAAUGUAGAGACCAGGACUACUUAUAUGCAUUUUAAUGGUUCAGAAACAGAUGUAGAGAGCUUCUUAGGUAGGGCGGCGU
<<<<<...............<<<<<<<<.<<<<..............>>>>.>>>>>>>>.........>>>>>............ .............................................................................................................................................
AY355264.1 1.00 GGCCUCAAUGAUGAAUUAGAGGAAGUUAUUGUCGAGAAAACGAGACAGACUUUAGCUUCCGUUGCAUCAGGACCAAAACACACCCA.GAGCGUGCCUAUUUUAACAGCAAAUGAAACUGGUGCCACCAUGCCAACUCAACCAUCAGACAAUGUUGAGACUAGGACUACUUAUAUGCAUUUUAAUGGAUCUGAAACAGAUAUAGAAAGCUUUCUGGGUAGAGCUGCAUGUGUACAUAUGGUU
....................<<<<<<<<........................>>>>>>>>.......................... ...........................................................................................................................................................
AY355267.1 1.00 GGGUUGGGAGAUGAACUAGAGGAAGUCAUAGUCGAAAAAACGAAACAGACGUUGGCUUCAGUUGCAACAGGUUCAAAAUAUACCCA.AAAAGUGCCAUCAUUGUCAGCUAAUGAGACAGGAGCAACCAUGCCCACAGUACCAUCAGAUAAUAUAGAAACCAGAACUACAUAUAUGAAUUU
...........<<<<<<....<<<<<<<........................>>>>>>>..........>>>>>>........... ..............................................................................................
AY355273.1 1.00 GGUCUUAAUGAUGAAUUGGAGGAAGUCAUUGUUGAGAAAACGAAACAGACAUUGGCUUCUAUCACUUCUGGACCCAAACAUACUCA.AAGUGUCCCCACGUUAACAGCAAAUGAAACCGGUGCCACCAUGCCUACUCAACCAUCAGACAAUGUUGAGACAAGAACAACCUAUAUGCAUUUCAAUGGUUCAGAAACAGAUGUUGAAAACUUCCUAGGUAGAGCAGCAUGUGUACAUAUGGUAGAAAUAGUUAAUAAAAA
<<<<<.......<<<.<<<.<<<<<<<<.<<<<..............>>>>.>>>>>>>>.>>>.>>>.>>>>>............ ............................................................................................................................................................................
K02121.1 1.00 .CUUAUACUUCCCCCAGAAACGACCGGCCAGGUCUACUUAUUAUCAUUCAUAAGUGCAUGUCCAGAUUUUAAGCUUAGGCUGAUGAAAGAUACUCAAACUAUCUCACAGACUGUUGCACUCACUGAA GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACAAAAAGUCCCCAUACUAACUGCAAACGAAACAGGGGCCACAAUGCCUGUUCUUCCAUCAGACAGCAUAGAAACCA
.............................................................................................................................. ...................................................................................... ..........................................................................
L05355.1 1.00 .CAUUCAUAAGUGCAUGUCCAGAUUUUAAGCUUAGGCUGAUGAAAGAUACUCAAACUAUCUCACAGACUGUUGCACUCACUGAA GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACAAAAAGUCCCCAUACUAACUGCAAACGAAACAGGGGCCACAAUGCCUGUUCUUCCAUCAGACAGCAUAGAAACCAGAACUACCUACAUGCACUUUAAUGGUUCAGAAACUGAUGUAGA
................................................................................... <<.<<<<<<<<.<<...............................................>>>>>>>>>>.>>............ .....................................................................................................................
X01087.1 1.00 .UCAAACUUCUCUUAUACUUCCCCCAGAAACGACCGGCCAGGUCUACUUAUUAUCAUUCAUAAGUGCAUGUCCAGAUUUUAAGCUUAGGCUGAUGAAAGAUACUCAAACUAUCUCACAGACUGUUGCACUCACUGAA GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACAAAAAGUCCCCAUACUAACUGCAAACGAAACAGGGGCCACAAUGCCUGUUCUUCCAUCAGACAGC
........................................................................................................................................ ...................................................................................... ................................................................