Seq ID Score (bits) Sequence
AY355187.1 0.00 GGAUUGGGUGAUGAAUUAGAAGAAGUUAUUGUCGAGAAAACGAAACAGACACUAGCUUCAGUAUCAUCAGGACCAAAACACACCCA.GAGTGTCCCCATATTGACAGCTAATGAAACAGGTGCCACTATGCCAACTAACCCTTCAGACAATGTGGAA
.....................<<<<<<<<<<<<..............>>>>>>>>>>>>........................... .......................................................................
AY355195.1 0.00 GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACA.AAAAGTCCCCATACTAACTGCAAACGAAACAGGGGCCACAATGCCTGTTCTTCCATCAGACAGCATAGAAACCAGAACTACCTACATGCACTTTAATGGTTCAGAAACTGATGTAGAATGCTTTTTGGGTCGTGCAGCTTGTGTGCATGTAACTGAAATACAAAACAAAGATGCTACTGGAAT
........................<<<<<<<<<..............>>>>>>>>>.............................. ........................................................................................................................................................................................
AY355216.1 0.00 GGCUUGGGAGAAGAGCUUGAGGAAGUCAUUGUCGAGAAAACGAAACAGACAGUGGCUUCAAUUGCUUCUGGAUCUAAACACACCCA.AAGTGTACCAATGCTAACAGCAAATGAAACAGGAGCTAGCATGCCCGTGGAGCCATCAGATAGTGTTGAGACTAGA
.....................<<<<<<<<<<<<..............>>>>>>>>>>>>........................... .............................................................................
AY355218.1 0.00 GGUCUGGGUGAUGAACUGGAAGAAGUUAUUGUUGAGAAAACGAAACAGACACUAGCUUCAAUAUCAUCAGGACCUAAGCAUACCCA.GAGTGTTCCTACACTGACAGCCAATGAAACAGGCGCCACCATGCCAACCAACCCATCAGATAATGTAGAAACTAGAACAACATACATGCACTTCAATGGTTCTGAAACGGACATTGAAAGTTTCTTGGG
.....................<<<<<<<<<<<<..............>>>>>>>>>>>>........................... ..................................................................................................................................
AY355253.1 0.00 GGUUUGAAUGACGAGUUAGAGGAAGUCAUCGUCGAGAAAACGAAACAGACGUUGGCUUCAAUUUCAUCCGGGCCAAAAUACACUCA.AAGTGTTCCCACTCT
.....................<<<<<<<<<<<<..............>>>>>>>>>>>>........................... ................
AY355260.1 0.00 GGUCUUAAUGAUGAAUUAGAAGAGGUCAUUGUCGAGAAAACGAGACAGACAUUGGCCUCUGUUUCUUCUGGACCUAAACAUACACA.GAGTGTACCTACATTAACTGCTAATGAAACTGGAGCCACCATGCCAACTCAACCTTCTGACAATGTAGAGACCAGGACTACTTATATGCATTTTAATGGTTCAGAAACAGATGTAGAGAGCTTCTTAGGTAGGGCGGCGT
....................<<<<<<<<<<<<<..............>>>>>>>>>>>>>.......................... .............................................................................................................................................
AY355264.1 0.00 GGCCUCAAUGAUGAAUUAGAGGAAGUUAUUGUCGAGAAAACGAGACAGACUUUAGCUUCCGUUGCAUCAGGACCAAAACACACCCA.GAGCGTGCCTATTTTAACAGCAAATGAAACTGGTGCCACCATGCCAACTCAACCATCAGACAATGTTGAGACTAGGACTACTTATATGCATTTTAATGGATCTGAAACAGATATAGAAAGCTTTCTGGGTAGAGCTGCATGTGTACATATGGTT
....................<<<<<<<<<<<<<..............>>>>>>>>>>>>>.......................... ...........................................................................................................................................................
AY355267.1 0.00 GGGUUGGGAGAUGAACUAGAGGAAGUCAUAGUCGAAAAAACGAAACAGACGUUGGCUUCAGUUGCAACAGGUUCAAAAUAUACCCA.AAAAGTGCCATCATTGTCAGCTAATGAGACAGGAGCAACCATGCCCACAGTACCATCAGATAATATAGAAACCAGAACTACATATATGAATTT
.....................<<<<<<<<<<<<..............>>>>>>>>>>>>........................... ..............................................................................................
AY355273.1 0.00 GGUCUUAAUGAUGAAUUGGAGGAAGUCAUUGUUGAGAAAACGAAACAGACAUUGGCUUCUAUCACUUCUGGACCCAAACAUACUCA.AAGTGTCCCCACGTTAACAGCAAATGAAACCGGTGCCACCATGCCTACTCAACCATCAGACAATGTTGAGACAAGAACAACCTATATGCATTTCAATGGTTCAGAAACAGATGTTGAAAACTTCCTAGGTAGAGCAGCATGTGTACATATGGTAGAAATAGTTAATAAAAA
....................<<<<<<<<<<<<<..............>>>>>>>>>>>>>.......................... ............................................................................................................................................................................
K02121.1 0.00 .CTTATACTTCCCCCAGAAACGACCGGCCAGGTCTACTTATTATCATTCATAAGTGCATGTCCAGATTTTAAGCTTAGGCTGATGAAAGATACTCAAACTATCTCACAGACTGTTGCACTCACTGAA GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACAAAAAGTCCCCATACTAACTGCAAACGAAACAGGGGCCACAATGCCTGTTCTTCCATCAGACAGCATAGAAACCA
.............................................................................................................................. ........................<<<<<<<<<..............>>>>>>>>>.............................. ..........................................................................
L05355.1 0.00 .CATTCATAAGTGCATGTCCAGATTTTAAGCTTAGGCTGATGAAAGATACTCAAACTATCTCACAGACTGTTGCACTCACTGAA GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACAAAAAGTCCCCATACTAACTGCAAACGAAACAGGGGCCACAATGCCTGTTCTTCCATCAGACAGCATAGAAACCAGAACTACCTACATGCACTTTAATGGTTCAGAAACTGATGTAGA
................................................................................... ........................<<<<<<<<<..............>>>>>>>>>.............................. .....................................................................................................................
X01087.1 0.00 .TCAAACTTCTCTTATACTTCCCCCAGAAACGACCGGCCAGGTCTACTTATTATCATTCATAAGTGCATGTCCAGATTTTAAGCTTAGGCTGATGAAAGATACTCAAACTATCTCACAGACTGTTGCACTCACTGAA GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACAAAAAGTCCCCATACTAACTGCAAACGAAACAGGGGCCACAATGCCTGTTCTTCCATCAGACAGC
........................................................................................................................................ ........................<<<<<<<<<..............>>>>>>>>>.............................. ................................................................