Seq ID Score (bits) Sequence
AY355187.1 0.00 GGAUUGGGUGAUGAAUUAGAAGAAGUUAUUGUCGAGAAAACGAAACAGACACUAGCUUCAGUAUCAUCAGGACCAAAACACACCCA.GAGUGUCCCCAUAUUGACAGCUAAUGAAACAGGUGCCACUAUGCCAACUAACCCUUCAGACAAUGUGGAA
<<.......<<<<........<<.<<<<.<<<<..............>>>>.>>>>.>>.....>>>>.<<..<............ .....>..>>..................................>>.........................
AY355195.1 0.00 GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACA.AAAAGUCCCCAUACUAACUGCAAACGAAACAGGGGCCACAAUGCCUGUUCUUCCAUCAGACAGCAUAGAAACCAGAACUACCUACAUGCACUUUAAUGGUUCAGAAACUGAUGUAGAAUGCUUUUUGGGUCGUGCAGCUUGUGUGCAUGUAACUGAAAUACAAAACAAAGAUGCUACUGGAAU
<<<......<<<<........<<.<<<<.<<<<..............>>>>.>>>>.>>.....>>>>.<<..<............ .....>..>>.................................>>>..........................................................................................................................................
AY355216.1 0.00 GGCUUGGGAGAAGAGCUUGAGGAAGUCAUUGUCGAGAAAACGAAACAGACAGUGGCUUCAAUUGCUUCUGGAUCUAAACACACCCA.AAGUGUACCAAUGCUAACAGCAAAUGAAACAGGAGCUAGCAUGCCCGUGGAGCCAUCAGAUAGUGUUGAGACUAGA
<<<......<<<<........<<.<<<<.<<<<..............>>>>.>>>>.>>.....>>>>.<<..<............ .....>..>>.................................>>>...............................
AY355218.1 0.00 GGUCUGGGUGAUGAACUGGAAGAAGUUAUUGUUGAGAAAACGAAACAGACACUAGCUUCAAUAUCAUCAGGACCUAAGCAUACCCA.GAGUGUUCCUACACUGACAGCCAAUGAAACAGGCGCCACCAUGCCAACCAACCCAUCAGAUAAUGUAGAAACUAGAACAACAUACAUGCACUUCAAUGGUUCUGAAACGGACAUUGAAAGUUUCUUGGG
<<<......<<<<........<<.<<<<.<<<<..............>>>>.>>>>.>>.....>>>>.<<..<............ .....>..>>.................................>>>....................................................................................
AY355253.1 0.00 GGUUUGAAUGACGAGUUAGAGGAAGUCAUCGUCGAGAAAACGAAACAGACGUUGGCUUCAAUUUCAUCCGGGCCAAAAUACACUCA.AAGUGUUCCCACUCU
.........<<.<........<<.<<<<.<<<<..............>>>>.>>>>.>>.....>.>>.<<..<............ .....>..>>......
AY355260.1 0.00 GGUCUUAAUGAUGAAUUAGAAGAGGUCAUUGUCGAGAAAACGAGACAGACAUUGGCCUCUGUUUCUUCUGGACCUAAACAUACACA.GAGUGUACCUACAUUAACUGCUAAUGAAACUGGAGCCACCAUGCCAACUCAACCUUCUGACAAUGUAGAGACCAGGACUACUUAUAUGCAUUUUAAUGGUUCAGAAACAGAUGUAGAGAGCUUCUUAGGUAGGGCGGCGU
<<<......<<.<........<<.<<<<.<<<<..............>>>>.>>>>.>>.....>.>>.<<..<............ .....>..>>.................................>>>...............................................................................................
AY355264.1 0.00 GGCCUCAAUGAUGAAUUAGAGGAAGUUAUUGUCGAGAAAACGAGACAGACUUUAGCUUCCGUUGCAUCAGGACCAAAACACACCCA.GAGCGUGCCUAUUUUAACAGCAAAUGAAACUGGUGCCACCAUGCCAACUCAACCAUCAGACAAUGUUGAGACUAGGACUACUUAUAUGCAUUUUAAUGGAUCUGAAACAGAUAUAGAAAGCUUUCUGGGUAGAGCUGCAUGUGUACAUAUGGUU
<<<......<<<<........<<.<<<<..<<<..............>>>..>>>>.>>.....>>>>.<<..<............ .....>..>>.................................>>>.............................................................................................................
AY355267.1 0.00 GGGUUGGGAGAUGAACUAGAGGAAGUCAUAGUCGAAAAAACGAAACAGACGUUGGCUUCAGUUGCAACAGGUUCAAAAUAUACCCA.AAAAGUGCCAUCAUUGUCAGCUAAUGAGACAGGAGCAACCAUGCCCACAGUACCAUCAGAUAAUAUAGAAACCAGAACUACAUAUAUGAAUUU
<<.......<.<<........<<.<<<<..<<<..............>>>..>>>>.>>.....>>.>.<<..<............ .....>..>>..................................>>................................................
AY355273.1 0.00 GGUCUUAAUGAUGAAUUGGAGGAAGUCAUUGUUGAGAAAACGAAACAGACAUUGGCUUCUAUCACUUCUGGACCCAAACAUACUCA.AAGUGUCCCCACGUUAACAGCAAAUGAAACCGGUGCCACCAUGCCUACUCAACCAUCAGACAAUGUUGAGACAAGAACAACCUAUAUGCAUUUCAAUGGUUCAGAAACAGAUGUUGAAAACUUCCUAGGUAGAGCAGCAUGUGUACAUAUGGUAGAAAUAGUUAAUAAAAA
<<<......<<.<........<<.<<<<.<<<<..............>>>>.>>>>.>>.....>.>>.<<..<............ .....>..>>.................................>>>..............................................................................................................................
K02121.1 0.00 .CUUAUACUUCCCCCAGAAACGACCGGCCAGGUCUACUUAUUAUCAUUCAUAAGUGCAUGUCCAGAUUUUAAGCUUAGGCUGAUGAAAGAUACUCAAACUAUCUCACAGACUGUUGCACUCACUGAA GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACAAAAAGUCCCCAUACUAACUGCAAACGAAACAGGGGCCACAAUGCCUGUUCUUCCAUCAGACAGCAUAGAAACCA
.............................................................................................................................. <<<......<<<<........<<.<<<<.<<<<..............>>>>.>>>>.>>.....>>>>.<<..<............ ....>..>>.................................>>>.............................
L05355.1 0.00 .CAUUCAUAAGUGCAUGUCCAGAUUUUAAGCUUAGGCUGAUGAAAGAUACUCAAACUAUCUCACAGACUGUUGCACUCACUGAA GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACAAAAAGUCCCCAUACUAACUGCAAACGAAACAGGGGCCACAAUGCCUGUUCUUCCAUCAGACAGCAUAGAAACCAGAACUACCUACAUGCACUUUAAUGGUUCAGAAACUGAUGUAGA
................................................................................... <<<......<<<<........<<.<<<<.<<<<..............>>>>.>>>>.>>.....>>>>.<<..<............ ....>..>>.................................>>>........................................................................
X01087.1 0.00 .UCAAACUUCUCUUAUACUUCCCCCAGAAACGACCGGCCAGGUCUACUUAUUAUCAUUCAUAAGUGCAUGUCCAGAUUUUAAGCUUAGGCUGAUGAAAGAUACUCAAACUAUCUCACAGACUGUUGCACUCACUGAA GGCUUAGGUGAUGAAUUAGAAGAAGUCAUCGUUGAGAAAACGAAACAGACGGUGGCCUCAAUCUCAUCUGGUCCAAAACACACACAAAAAGUCCCCAUACUAACUGCAAACGAAACAGGGGCCACAAUGCCUGUUCUUCCAUCAGACAGC
........................................................................................................................................ <<<......<<<<........<<.<<<<.<<<<..............>>>>.>>>>.>>.....>>>>.<<..<............ ....>..>>.................................>>>...................