Seq ID Score (bits) Sequence
AE001820.1 0.00 .UGAGACAAUAGACGAUCUUCUCAAAGAAGCAGACGAUAACCUCUAUCUGGCAAAACAGCGUGGAAAAAACAGAGUGAUCGGCAGAUGAAGUUAAAAGAUCUGUUCACCUUCUGGAAAUAAAUCCUUGAUAGAAUGGAGAAAACUGAAUACAAAAG AAACGCUCUCGGGGCAGGGUGGAAUUCCCGACCGGCGGUGA..................................AAGCCCGCGA.GCc..........................................................CUCUCAGGAGGGUUGA.CCCGGUGGAAUUCCGGGGCCGACGGuGAAAGUCCGGAUGGG.AGAGA.GCGUGAUGUGGAGGUUAUAUGGGACCCGAGAGGGUCCCUU
........................................................................................................................................................... .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. ..................................
AE001878.1 0.00 .CGUACCCUGAACGCGGUUCUUCAGGAACC GACCUCUUUCGGGGCGGGGCGAAAUUCCCCACCGGCGGUAAguucucccgaac......................AAGCCCGCGAaGCccgcgcaaaccgcac............................................CACGCGCCGGGCCCGA.UGCCGCGCAACUCGGCAGCCGACGGuCACAGUCCGGACGAA.AGAAG.GAGGAGACGCUCAGCUUGCCCCCCAGCAGGCGGCGUCCGCGUAUGAAUACGGAA
............................. ......<.<<.<<<<..<<............>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>............... ................................................
AE004431.1 0.00 .GAAACACAA CAAUAUUCUCAGGGCGGGGCGAAAUUCCCCACCGGUGGUAUgccgcaaggc........................GAGCCCACGA.GCgcucgauu...................................................CGUCGAGGUCAGCAGA.UCUGGUGAGAAGCCAGGGCCGACGGuUACAGUCCGGAUGAG.AGAGA.AUGACAAACACACUGAAUCUCAAGGUGCGGCGUUGCUACAUCUUUUGGUUUUCAGUGCUUUUCGUUUUGGAUUUUGAUCCCUCAUAAGCCCUGAUUCUGGUCAUUUUUUGGAGUAUUACCAUGAAUCAGUCCUCAUUACUUGCCGAAUUCGGCGACCCCAUUACUCGUGUAGAAAACGCACUGCAAGCCUUACGUGA
......... .......................................................................................................................................................................................................................... ..<<.....<<<......<<...........>>.............................................................................................<...........>..............>>>.....>>............................
AE004822.1 0.00 .UUGCGGAUCGACGACAUCCGCGCGGUGGGCGACGACUGGCUGGUCACCGCGCGGCCCCAUCUGCGGGACGCCUGAACUUCGCUGCGCGGCGACGCGGCGGACGAUGCACAAGCGGCGCAACUGUGGUAAAACGCCACACGGCCAUCUCGGUGGCCG UAACGUUCUCAGGGCGGGGUGAAAGUCCCCACCGGCGGUAAuggcgcgcaaggcgcc..................UAGCCCGCGA.GCgcuugccggaccggccaccgccgga..................................CGACAAGGUCAGCAGA.CCCGGUGCGAUUCCGGGGCCGACGGuCAUAGUCCGGAUAAAgAGAGA.ACGGGAUUGCCUGCCUGGGCGUACCCUGUGCGCCCGCAAGAUCCCCUUCG
............................................................................................................................................................ .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. ............................................
AE006176.1 0.00 .CUUCAGCAUCUUGUCCCAAGUCUUUAAUCCCUUGUGGAAGAGAGUCUUGGAUUUGUUGUAUAACUUGCUCUAUUUUUUUCGGAUUUAGCAUAAUCGCCUCAUAUUUUUUGAAAUUUCAUCUAUUGUAUGUAAUCUUGCUACAAAUAAAAACAUUUUUUCGAGAUUAAGUUUGCGUUAUACUAUUU GCGCAUUCUCAGGGCAGGGUGAAAUUCCCUACCGGUGGUAAauguauaacau.......................AAGCCCACGA.GCguuuacuauuucaugucacaagaga..................................UAGUAAAGUCAGCAGA.UUUGGUGAGAAUCCAAAGCCGACAG.UAUAGUCUGGAUGAA.AGAGA.AUAAGCAGGUUUUGUGUGCAA
......................................................................................................................................................................................... .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. ...............
AE006333.1 0.00 .GUGGACUUUAAUAAAGUAGGGUGAUGUUCGCUUGUACUAUCUGUCUGUGAACUUUUAAUGUUUGAUUUUAAUUUGUUAACUUAAAGAAUACGUUUUUAUUUCUUGACAAUCUUUAAAUUUAAAUGCUAUACUUUAGCUACAAUUGA AUAAAUCUUCAGGGCAGGGUGUAAUUCCCUACCGGCGGUA-..................................UAGCCCGCGA.GC...........................................................--UGCUUGCAGCAUGA.UUCGGUGAAACUCCGAGGCCGACAG.UAUAGUCUGGAUGAA.AGAAG.AUAAUAAAACCAUAAUACUCUAGUCAGUAUUAUGUCUAUUUAGCCUAAAACUCUGGAGUG
.................................................................................................................................................. .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. ......................................................
AE006360.1 0.00 .CCAAGGAAAUUAAGUGAUUAUUAUAAAAGACAAUUCUGGUAAAGAGUUGUUUUUUUAUUUCUUAAGCAAAUCUUAUUCUUGAUAAGCAAACUAUUUUUGUGCUAUAAUAA AAAUAUCUUCAGGGCACCGUGUAAUUCGGGACCGGCGGUAAauagggcuuugaccuuau................GACUCCGCGAu--...........................................................UCGCUACGGCGAUUGA.AGCAGUGAGAAUCUGCUAGCGACAG.UAAAGUCUGGAUGGA.AGAAG.AUGAACAAUUUUUGUAGUGUAAUCAACUUCGGUUGGAUUACUGUUUUUAGCCAAACCAAAAAUGUCUAUCAACUUCCUCGAAAUUUGAAGAAUUAU
.............................................................................................................. .....<<.<<.<<<<...<<..........>>....................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. ..........................................................................................
AE007333.1 0.00 .GAUUAUCACAAAUACAGUAUAUCAAAAACAAUCGGUAUUUAUCUGUUGACAUAUUCAAAAUUAAGUACUAUAAUCAUCUGUAAUUGAAU AACUAUCUUCAGGGCAGGGUGAAAUUCCCUACCGGUGGUA-..................................UAGCCCACGA.GC...........................................................----CGAAAGGCAUGA.UUUGGUGAAAUUCCAAAGCCGACAG.UAUAGUCUGGAUGAA.AGAAG.AUAAAAGUAUAUUUGUGCUUUUUGCGUGCUCUGAAAUGAUUACUUGUCAUUUCAGAGCAUUUUUGUUAAUCGCAUAAGUUUUCUUUUGUAUGCCUUGAGUAGUCCCCUAUUCAAGGU
......................................................................................... .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. ...............................................................................................................
AE007574.1 0.00 .AUUUAUUUUAUUUAUAUUUAAAGAAAAAUUCCCUCUUUCCAUUAUUUAGCCUCCAGAUAAGUAUAAUAUAUAUUAUGAAUUAUAGCAUAUUUAUGGAGUGUUGACAUGGAAAAUAUUAAGUAGUAUACUAAUGGUAAUUUAAUAG GAUGUUCUUCAGGGAUGGGUGAAAUUCCCAAUCGGCGGUA-..................................AAGCCCGCAA.GC...........................................................-----CAUUUGGCAGA.UCCGGUUAAACUCCGGGGCCGACAGuUAAAGUCUGGAUGAA.AGAAG.AAAUAGCGUAACUGCAGUACGCAGGUUUUGUUGAUUAUAAAUCUCCGAAGGAUUACCUUUC
................................................................................................................................................. .....<<.<<.<<<...<<<..........>>>...................................................................................................................................<<<<<.......>>>>>..............>>>.>>.>>.............. .......................................................
AE007781.1 0.00 .GUUAGAAUUUUAGAAGUCGAUGAGAAAAGAAAUAGGAUAUCUCUGACAAUGAAAAAAUAGCCUAAAGGACUUGAACUUGUUAUAAUUAUGAUAUAUAAUAUAAAAAAAUAAAG AAUGAUCUUCAGGGCAGGGUGAAAUUCCCUACCGGCGGUA-..................................UAGCCCGCGA.GC...........................................................--CUUUUUAGGUAUGA.UCCGGUUUGAUUCCGGAGCCGACAG.UAAAGUCUGGAUGAA.AGAAG.AUAUAUAGCAUUAUUUUGAUAUGUAUGCCCUGACGUUUUUCGUUGGGGCUUUUUUAAUGCUUCUGAAGAUUUUAGGAGGGUUUAAGUUGAAGA
................................................................................................................. .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. .......................................................................................
AE008109.1 0.00 .AUUCGUCAUCGGCCGCGGAAAGGAAAUACCCGGUUUCGGGCACAAUCAGAAUGUUCUUUUCGCACUGACCGGUCGUCGCAGAGCAUUGCCCCUUGAUUCCUUCCCAUUUGAUAAUUUAUGUUGU GGUUGUUCUCAGGGCGGGGUGCAAUUCCCCACCGGCGGUAUcgggauuugucccg....................GAGCCCGCGA.GCgcuuccggucuccaaag..........................................CCGGAAGGUCAGCAGA.UCCGGUGAGAGGCCGGAGCCGACGG.UAUAGUCCGGAUGGA.AGAGG.ACAAGGCAUAAAGACGCCCGCACUCUGUGGGCUUCGCAUUGCAUUGUUCGCCCAAGGGAUAUUUGGCGCUUCUUGAAGCGCG
............................................................................................................................ .....<..<..<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>..>............... ............................................................................
AE008399.1 0.00 .AGUAUAUCAAAAACAAUCUGUAUUUAUCUGUUGACAUAUUCAAAAUUAAGUACUAUAAUCAUCUGUAAUUGAAU AACUAUCUUCAGGGCAGGGUGCAAUUCCCUACCGGUGGUA-..................................UAGCCCACGA.GC...........................................................----CGAAAGGCAUGA.UUUGGUGAAAUUCCAAAGCCGACAG.UAUAGUCUGGAUGAA.AGAAG.AUAAAAGUAUAUUUGUGCUUUUUGCGUGCUCUGAAAUGAUUACUUGUCAUUUCAGAGCAUUUUUGUUAAUCGCAUAAGUUUUCUUUUGUAUGCCUUGAGUAGUCCCCUAUUCAAGGUAUAUUUUUUGGAGGU
.......................................................................... .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. ..............................................................................................................................
AE009695.1 0.00 .CUGGACAAAUUCAGGAUCAGUGCAUAGUUUCCGCGUGCUCGCGCAAUGGUGCGCGG GCUUGUUCUCGGGGCGGGGUGAAACUCCCCACCGGCGGUAUgaaaagcaauuuuc....................AAGCCCGCGA.GCgccugaaauggaagccgauucgcaugcca..............................UUUCAGGGUCAGCAGA.UCCGGUGAGAUGCCGGAGCCGACGGuUAAAGUCCGGAUGGA.AGAGA.GCGAAUGAGCGUCACGAUUGCGCCUUCCGGCGUCGUUCUUGCGUUCUUUUGUGCGCCCUGAUUCUAGUUUCGUGAGGAACCUAUGAACCAAAGCUGUCCGAACAAGACAUCCUUUAAAAUCGCAUUCAUUCAGGCCCGCUGGCACGCCGA
........................................................ .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. ................................................................................................................................................
AE010459.1 0.00 .AAAUUAUUUUUAACCUAUUUGGUAUUGUAUCAGUAUAACAUAUUUAGCAAAUAAAAACAAUUAGAUAAAAAUAUUUAAAAGAACAUCAAACUAAUUUUUAUAUAAAAAUUUUUUUAAAUAAAUCUUGACAAAUUAAUAAAAGAAUAUUAUAUUAAUGAUGUAAAUAAUCGAAUAUGUAAAA UAAAGUCUUCAGGGCAGGGUGAAAUUCCCGACCGGUGGUA-..................................CAGUCCACGA.--...........................................................-AAGCAUUUGCUUUGA.UUUGGUGAAAUUCCAAAACCGACAG.UAGAGUCUGGAUGGG.AGAAG.AAUUAGAUUUUUUAAUUAUACUCAU
..................................................................................................................................................................................... .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. ...................
AE012168.1 0.00 .AGCCUUCACGAUUCUGGCUAUGGGGAAUUUCCCGACAUGACGCAGCGUCCUGCCAGGCAUGUCUUGGCAGUCAGCUAUCGCCGGAAGCCGCCCUGUAGAAUUGACGCGCCGGUUCGCCGGUACUUAC GAACGUCUUCAGGGCGGGGUGCGAUUCCCCACCGGCGGUAUgcaugcgcaagcgugu..................GAGCCCGCGA.GCgcuucgcugccgaucucucgcugagagcacggc..........................GGUGAAGGUCAGCAGA.UCCGGUGCGAUGCCGGGGCCGACGG.UAUAGUCCGGAUGAA.AGAAG.ACGGCCAACGCGCAGCCCUUGCGGCUGCGCGCGCGCCUGUUUGCCUUGCGGCGUUUUUCGCUCAACUUUUUUGCGAGAA
............................................................................................................................... .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. .........................................................................
AE013024.1 0.00 ---------CGGGGCAGGGUGGAAUUCCCGACCGGCAGUGA..................................AAGCCUGCGA.GC...........................................................-CGCAUAUGCGGUUGA.CUCGGUGAAAUUCCGAGGCCGACGGuAAAAGUCCGGAUGGG.AG---.------.AAGAUUUACUUUUUUGUGCCUAUUUGUGUAAAUUAUUUGUAAAAAACCCCUGAAGAUUUGUCUUCAGGGGUUUUUUAAUAGAAAAAGCAAAAGUUGGAGGUGUAUUUAUGGAAAAAGUUAAAACACAAGCUUUAGUAAAGGUAGGUUUUCUUUCAGCUACAGCUUUUA
_________<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>.................. .........................................................................................................................................................................
AE014142.1 0.00 .AAAAGCGUCAGUUUUUGGCAACAUGCGUUGUCAGUAGCUGACGCUUUUAAAAAUUUAGUCAAAGCUAUUGCUAUCUAGGUUUAAAUCUGCUAUGCUAG AAGUGUCUUCAGGGCAGGGUGUGAUUCCCGACCGGCGGUGAcuagguaacuag......................AAGUCCGCGA.GC...........................................................-------GCAAGCUGA.UGUGGUGUAACUCCACAACCGACAG.UAUAGUCUGGAUGAG.AGAAG.ACCGGGCUUUUUGUGUAGGCUUAUUUUAGCUACACAAUAACGACGGAACUUCUUUCAAUUUGAAAAAAUUGGAGGAAUUUUUUAAUGUCAAAAACACAUAAAAUGAUU
.................................................................................................. .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. ......................................................................................................
AE014618.1 0.00 .UCUGCACAGUGAAACGCGGGUUGCAUACGUCCGGCGCAUGGCGUAUGAAUAAGCC UGUCAGUUUCAGGG-AAGGUGCAAUUCCUUACUGGCGGUAAccugcaccccggguuucauaacggggauggcaggAAGCCCGCGA.CC...........................................................-CGCGCAAGCGGCUGA.UCCGGUGAGAUUCCGGAGCCAACGG.UAUAGUCCGGAUGGA.AGAAA.CGAGGGCUCAUUAUGAGUGUAUCUUCGCGUAUUCGCAUGCAAGUUGUUCGUUCUGUGGCACCCGAGGCCGAGGGUUCGGCCAGCACGUCCACCGCCAGCACCAGCGCCAAACUUGGCUCACACACCACUGGUGUGGCCGAUUCUGGCCGCU
....................................................... ........................................................................<<<<....<......................................................................>.................................................................. ................<...........>...............>>>>.................................................................................................
AF269345.1 0.00 .CUACUGGACUCAAUUAAUCAUAACAAUUUCAUA UAUUUCUUUCGGGGCAGGGUGAAAUUCCCAACCGGCAGUAAauu...............................GAGCCUGCGA.CCcacuaauauuguuuu............................................UGAUGUUAGUGGCUGA.UCUAGUGUGAAUCUAGAGCCGACAGuUAGAGUCUGGAUGGG.AGAAA.GAAGUUGAAUUAUCGACUUACACAAAUUCGUGUAGUUAUGAUAAGCGUAUUGUAUACUUAUGUGCAAUUUUAAGUAUGCUAAUAGGCUUAUUUAAAGAUAUAGAUAUCUCCUUAUGCCUACAAUAUAGGUAUAAGGUUUUUUUUGAGGUGAUCAAUUGAGUAGAUUUAUGGAU
................................. .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. .......................................................................................................................................................................
AF269712.1 0.00 .AAAACAUUAUAUUAACCGUAAGCAGAAAUAUUGAGUUUUUAAAACUAAUCAUGUAAUAUAAAUUUAAAAUAAAAUUGAUAU AUUCAUCUUCGGGGUAGGGUGUAAUUCCCAACCGGCAGUAAucu...............................AAGCCUGCGA.-Cgacaacguauuaau.............................................UUUUGCUUUGUCUUGA.UUCAGUGAGAGUCUGAAGCCGACAG.UAUAGUCUGGAUGGG.AGAAG.AUGGAGGUUUUUUGUUGUUCAAAUUUCCUCCUUUUCUAAGUAAGAUGAAUGGAAGGAGAAAAUUAUAUAUGCAACAAAACAAACGUUUGAUUACAAUUAGUAUGUUAAGUGCGGUAGCGUUUGUG
................................................................................. .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. .......................................................................................................................
AJ009832.1 0.00 .ACGAACAGGUAGAAAGGUGAUAGAAGAAAUCCUUUCUCUUCCAGAAAACGAAGAGAUGAGAAAGAAUUAUCUGAAAAAAUAAGUUCAUCUUCCCAGAAAAGAGAAACCGAUACAAUGGAAGAAACUGAAUAGUUUCGAA GAUCGCUCUCGGGGCAGGGUGGAAUUCCCGACCGGCGGUGA..................................AAGCCCGCGA.GCc..........................................................CCCUUCUGGGGGUUGA.CCCGGUGGAAUUCCGGGGCCGACGGuGAAAGUCCGGAUGGG.AGAGA.GCGAAGAGUGUAGACCAUCAGGGACCCGAGAGGGUCCCUUUUCUCUUUAAAAAGGGGUGAAAAUGUG
........................................................................................................................................... .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. .............................................................
AJ010128.1 0.00 .UUCACUUGUUCAUUAUUCGAACAUUUUUUACUAGCCUUUUUUCUUUUUUGUGCUAUAAUUUGAGCAAA CAGCAUCUUCGGGGUCGGGUGAAAUUCCCAACCGGCGGUGAugaagugcaaacuucu..................AAGUCCGUGA.CCcguuuuca...................................................ACUCGAAAACGGUGGA.UCUAGUGAAACUCUAGGGCCGACAG.UAUAGUCUGGAUGGG.AGAAGgAUAUGUUUUCUAGUAAUUUUAUAUAGCGAAUACACUUUUAUUUCAGUAUGCAUAUUUUUAAGUUUCAUUUUGAAUCUUUAUAUAUGUUUUAUUUUGUAUACUUAUGUUUCUAUACUGGAAUAAAAAGAUACGACUAGC
.................................................................... .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. ....................................................................................................................................
AL591790.1 0.00 .GCUCGUCAUCCGCGAAUAGAGCGGCCGGAAUGAAUUGUUCAGGGGCGUGAAAUCCUUGGAAAAUUCUGUCGUGAUUUUUCGCUUUCACGUCGCAGCACAGAUUUGACGGCGGCGAAACAGCCGCUAUAGUCGC AAGCGUUCUCAGGGCGGGGUGAAAUUCCCCACCGGCGGUAGcgaacacaggaucgggaauggucgguggucg...GAGCCCGCGA.GCgcuucgcauuucg..............................................UGCGAAGGUCAGCAGA.UCCGGUCGAAUUCCGGAGCCGACGGuUAUAGUCCGGAUGGA.AGAGA.GCAAGCAGAAGCGUCGCCCCUCCCCGGGGUCUUCGCGCAUGCAUGUUCGCCCGACGGGAUCAUUGGAAAAAUG
..................................................................................................................................... .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. ...................................................................
AL591981.1 0.00 .AAAACCAAUCAUUAGCGGAAUCAUUAUCAACAGAUAUUCCGUGGUGAAUAAAUAAAACCAGCUAAUUGGCUGGUUUUUAUUUACUUUGAAUAGAAAGCGCUUACGUGAAAAAAUAUACAAAAGGACUUGCCAAAAAAUUUUUUCAUGGUAAAAUGAAAAUUGUAAGAAAAUAUUC GUUCAUCUUCGGGGCAGGGUGCAAUUCCCGACCGGUGGUUA..................................AAGUCCACGA.UCug.........................................................CUUUUUUAGCAGUUGAcUCUGGUGUAAUUCCAGGACCGACAG.UAUAGUCUGGAUGGG.AGAAG.AUGUUGGCAGACCUUUUCGUUUGUCUUCACG
............................................................................................................................................................................... .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. .........................
AL596170.1 0.00 .AAAGCGCUUACGUGAAAAAAUAUACAAAAGGACUUGCGAAAAAAUAUUUUCAUGGUAAAAUGAAAAUUGUAAUAAAAUAUUC GUUCAUCUUCGGGGCAGGGUGCAAUUCCCGACCGGUGGUUA..................................AAGUCCACGA.UCug.........................................................CUUUCUUAGCAGUUGAcUCUGGUGUAAUUCCAGGACCGACAG.UAUAGUCUGGAUGGG.AGAAG.AUGUUGGCAGACCUUUUCGUUUGUCUUCACGAGCAUGUGUUAGCAAGCUGUGAUGCUUAUUUGAGUAUUCAGUGCUUGUUUAAUUAAUCACAAACUCUCCCUCGACUUUUUUUAGUUGAGGUUU
.................................................................................. .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. ......................................................................................................................
AL646083.1 0.00 .GCUUG GUACGUCUUCAGGGCGGGGUGGAAUUCCCCACCGGCGGUAUgcgggccaucggucugc.................GAGCCCGCGA.GCgcccggcaugcgcagcgca........................................UGCCGGGGUCAGCAGA.UCCGGUGAGAUGCCGGGGCCGACGGuCAGAGUCCGGAUGGA.AGAAG.AUGUGCGGAACGAUGCGCGCCCGCGCCGCGGGUGCGGCCUGCCUUGCGCCGGCCGCGCCUUCGCGCGGCGCGGGCGCGCGCUUCCGCGUGCCCUGGAACGUCUUGUCGCCCAUUUCAGCGAGGAGCGUUUCCAUGUUGUCCACACAGCCAUCCCACGCAGUGCAUCCGCCCGCGUUGCCGUCCGGCGACGCGAGCGCCGAC
..... .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. ...................................................................................................................................................................................................
AL766847.1 0.00 ------CUUCGGGGUCAGGUGAAAAUCCUAACCGGCGGUA-..................................UAGUCCGCGA.GC...........................................................----UUUCGAGCAUGA.ACUGGUGUGAUUCCAGUACCGACAG.UAAAGUCUGGAUGAG.AGAAG.------.AAUUCAGUGAUUGUCUGCUACUUGCAGUUUAUUUGUGCUGGAUUAAUGAGAGACUCCCUAUAGUUUUCUAUAGGGAGUCUUUAGUUUUUUUGUGCUACCUAAAAUAUAAUGCUAAUUAGUAUAAUCAACGACUUCUCAUCCCUCCCCUUAGUUUUCUAUUUU
______<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>............... ...................................................................................................................................................................
AL766851.1 0.00 .GACAAUUCUUGGUUGUAUUAUUUUGGGAAUUUUGUUUAUCUUUUUAAGAAAAACUAAAAAUAGCAAAUCUGAAAGAAACGAUACAGCAUAGUAAUUUGGUAUUAAUAUGAUUUUUAAUCACUACUACUAAUUAGUAAUUAAAAAACUUGCAAUUGCAAGUUUUUUUUGUUAUGCUAU AGGUGUCUUCAGGGCAGGGUGUAAUUCCCGACCGGCGGUAAucgcuuccaacuuauuugucaguugugaagcau.CAGUCCGCGA.GC...........................................................-------GAAAGCUGA.UGUGGUGAGAUUCCACAACCGACAG.UAAAGUCUGGAUGGG.AGAAG.ACAAAGGUUUUUUUCGCGUACCUACGCUU
................................................................................................................................................................................. .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. .......................
AL939108.1 0.00 .CUCAAGGCGACGGUGCGGCCGCCCGGUUGGCGCCCUCCGCGCCCGGCGAUGACCACCCUGUGAGCCACUCCACACGCUCCGUUCGCAUGAAGGUGGAUCAGGCGUGGCACACUGGCCGUGUACCAGAAG CAGCGCACUCCGGGGUCGGUGAAAGUCCGAACCGGCGGUUA..................................CAGUCCGCGA.CCcggucgcc...................................................UCCAGCGACCGGUUGA.CCAGGUGAAAUUCCUGGACCGACGGuUAAAGUCCGGAUGGG.AGGCA.GUGCGCGGCGGGCGAGCAUUCGUGCGCGCCGCCGAUUUCUGGGCGUGCCUUUCAGGGGUGCGCCCCGUGCGGCGUCG
................................................................................................................................. .....<..<<.<<<...<<<..........>>>...................................................................................................................................<<<<<.......>>>>>..............>>>.>>..>.............. .......................................................................
AP001512.1 0.00 .AAUUGAAUAAUUAAUU UUUAUCCUUCGGGGCUGGGUGGAAAUCCCGACCGGCGGUGAugaagcgaaugcuucu..................UAGUCCGUGA.CCcgguugcugau................................................AUCAGUAAGCGGUGGA.CCUGGUGAAAAUCCGGGACCGACAGuGAAAGUCUGGAUGGG.AGAAG.GAAACGUACGGUUCAAUUUGGAAAAAUGUGCAUGAUUGCACAUCUUCUUUCUCGUGGGCAAAAAACCUACGUAUACACAAGGGAGAAGUCUGUCCAAAUGGAACCACUGCUUGUCGCAUGACAACGUGCGAAUGCAUUUUCGUAUGUCAAAGUAUGCCCCGUGAGAACAAAAUCUCUGGGGCUUUUUUGC
................ .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. ........................................................................................................................................................................................
AP003011.2 0.00 .CCGGCCUGCAAACGGCGGCUUCCUGCGCUUCCGGUGCUCACGUACGAAAAGUACGCUCCGCUCCGGUUCUCGGAAAGCACCGUUUUCGACUCGGCCUAACCUGAAUCUCAACACACCUUAGUCGACGGAACGUGAUGGGCCAGGACUUUCACGCGGUUGACAGCGCCGCCCUGCCCUUUCAUACAAACGACGU UAAAGUUCUCAGGGCGGGGUGAAAGUCCCCACCGGCGGUAAgggccucaaaccc.....................AAGCCCGCGA.GCgcuuuccaagacaau............................................UGGAAAGGUCAGCAGA.UCCGGUGUGAUUCCGGAGCCGACGGuUAGAGUCCGGAUGAA.AGAGG.ACGAAACGGAAAA
................................................................................................................................................................................<.<<..........<.< ...........>.>......................................................................................................................................................<<<<<.......>>>>>..................>>.>............... .......
AP003134.2 0.00 .CCAAUGUAUCACUCUCCAAUAAUGUAACUAUGAUCUAAUUAAAGCAUAGUUAUUGAGGUUUUGUGAUAUAUAGUAUAAAAUUAAUGAGAAUUAAAUUUAAUAAUGUAAA AUUCAUCUUCGGGGUCGGGUGUAAUUCCCAACCGGCAGUAAaua...............................AAGCCUGCGA.CCugcuaguaugua...............................................UCAUAUUAGUGGCUGA.UCUAGUGAGAUUCUAGAGCCGACAG.UAUAGUCUGGAUGGG.AGAAG.AUGGAGGUUUUUUGUUGUGCAAUAAUCCUCCUAUUCUUACGAGAUGAAUGGAAGGAGAAAAUUGAAUAUGCAACAAAAUAAACGUCUUAUCACAAUA
............................................................................................................. .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. ...........................................................................................
AP003135.2 0.00 .GAAGGUUUGAUUUUAAUGUCUGUUAGUAAGAAUCAUAUCAAUGAGAUGCCUAUAGUACUCAGAUUAUAUUAAAUUAAAACCGUCAUUAAUUGUUUUUUCAGAAAACAUAUAGUAUCAUUUUAAAUGUAGUUGACAUACUACGUACUCAAAUAAUCUAUAACAAUUUCAUAUA UAAUUCUUUCGGGGCAGGGUGAAAUUCCCAACCGGCAGUAAaua...............................AAGCCUGCGA.CCugcuaauauguu...............................................UCAUAUUAGUGGCUGA.UCUAGUGAGAUUCUAGAGCCGACAGuUAAAGUCUGGAUGGG.AGAAA.GAAUGUUAAUUAUCGACAAAGAUAAUGUAGCGUA
............................................................................................................................................................................ .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. ............................
AP003187.2 0.00 .CAGGCAAACUUUUUCCAAUGGAUAAUAUAAAAAGUAGCAUUAUUGAGGAAAUAAAGAAUAUGUGAUGAUUAUAUAGUGAGAAUUAGAUUUUAUAAACUAAAUAGGAAAUUGACAUGAAAAAGUUUAAAUGGUAAUUUAUAGAUAUAAUUUAAUA AAAAUUCUUCAGGGCAGGGUGAAAUUCCCUACCGGCGGUA-..................................AAGCCCGCGA.GC...........................................................---UAGUUUAGCAUGA.UUCGGUGAAAUUCCGAGGCCGACAG.UAAAGUCUGGAUGAA.AGAAG.AAUAUCUAAUAAGUUAUCUUUUUAUUAUGUUUUAUAUGCAUAUUAAAUGGAG
.......................................................................................................................................................... .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. ..............................................
AP003193.2 0.00 .UAAGGUUGGAGAUAUAGUAGAAGUUAGAAUAUUAGAUGUUGAUUUAAAAAGAAAGAGAAUUUCAUUAUCAAUGAAAAAAGAAGGUUAAGUUAGAAAAUUAAUUAAAAUAAGUGAAAAUUUUAGUAGAUAAAAAUAUUUAAUAUAUUGAAAUUUAUAUAAAAAAGAGUUAAAAUUAUAACAAAUGAAAUAAA AAAAGUCUUCAGGGCGGGGUGUGAGUCCCCACCGGCGGUA-..................................AAGCCCGCGA.GC...........................................................-UAGUUUUUAGCAUGA.UUCGGUGAAAUUCCGAGGCCGACAG.UAUAGUCUGGAUGAA.AGAAG.AUGAGUGUUUAAUGA
............................................................................................................................................................................................... .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. .........
AP004600.1 0.00 .GCAUUUGUAUUUGGAGGACAUUUAGGUUUUGUUGCAGGUAUAGAAUCAUCCAUGGUGACUGCAAUGAUAAUUGGUAAGCUAUCCGCAGGUAUUUCAGCAUUGACGGUAGCAUUGUUAUUGACUUCAUCAGAAAAUAGUAAUUGACUUGCCAAAAAGUCAAUGUAAAUGUAUAAUUAUUUCUAACAAAUAAAUAUUCGAU UCCAAUCUUCGGGGCAGGGUGCAAUUCCCGACCGGCGGUA-..................................AAGUCCGCGA.GCugca.......................................................UACAUAUUGUGGUUGA.UCUGGUUAAAUUCCAGUACCGACAGuUAUAGUCUGGAUGGG.AGAAG.AUGUCGA
....................................................................................................................................................................................................... .....<<.<<.<<<<..<<<..........>>>....................................................................................................................................<<<<.......>>>>..............>>>>.>>.>>.............. .
AP004604.1 0.00 .AACAAAAGCUUAAAUAUCUAUGAAGUUCAAACUGUAUUGGCGAGCUACGUACUUAAUUAAUUUCAUUUGACAUUAUACAUCGAAAGUUCUAAACUUUUAUGUAGAAUUGAAUAG UGUAUUCUUCGGGGCAGGGUGUAAUUCCCGACCGGCGGUGAcaagucaucagaacuug.................AAGUCCGUGA.CCc..........................................................GCUUUUAUGCGGUGGA.UCUAGUGAGAAUCUAGAGCCGACAGuAAUAGUCUGGAUGGG.AGAAG.AAUAGCUGUAUGGAUACGUAUAUCUAUUUGAUGUGGAGAAAACGAUGUUUUUUCUAGCUGUCUUACAUUUACGUAUUUUUACACAUAUCGUU
.................................................................................................................. .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. ......................................................................................
AP004827.1 0.00 .UCAAAAAAGCCAUCUCAAAAAUUAAUCAAACAAACAACAUUCCAACCAAUGCUCGCAAAUCGCAAAUUCAUUAUACAUCACCAACUUAAUUAAUUUUCAUUUUAAGCAUAGUUAUUGAGGUUUUGUGAUAUAUAGUAUAAAAUUAAUGGGAAUUAAAUUUAAUAAUGUAAA AUUCAUCUUCGGGGUCGGGUGUAAUUCCCAACCGGCAGUAAauu...............................AAGCCUGCGA.CCugcuaguaugua...............................................UCAUAUUAGUGGCUGA.UCUAGUGAGAUUCUAGAGCCGACAG.UAUAGUCUGGAUGGG.AGAAG.AUGGAGGUUUUUUGUUGUGCAAUAAUCCUCCUAUU
........................................................................................................................................................................... .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. .............................
AP005214.1 0.00 .AUCCGAGGGUGGCGAAUGCACAAGGGUUGUGGUGGGGAUGAAUGGAUUUCGUGUCGGGGGUCACUGGGGCGGGUUAUGCUGA GGGUGUUCUCAGGGCGGGGUGUAAUUCCCCACCGGCGGUGAgaguguccuccagauggggaggcuc.........AAGCCCGCGA.GCgccaccguauuccgcuuaugg......................................AGGGUGGGUCAGCAGA.UCCGGUGUGAUUCCGGAGCCGACGGuCAUAGUCCGGAUGGA.AGAGA.ACCGUGGUGUCGGCGACUCCGUGUGCCUUAUGGGCGCGGUUGUUGGCGUACCCGGAUUGAAGGCCCCGAGGAUUACAUGUUUUCUGUCCUGUGGAGGGGUCUGAUCAUGAAUCCUGUAACUGAG
.................................................................................. .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. ......................................................................................................................
AP005274.1 0.00 .UUUCCAAGGAAAUCUGGAUAGGUGGUUGUCACAAGUCCUCCUCUAAGUGGGCUUGUCGCCCACGGUAGUAGUCACCGCUGGCGAAUACCGGGGACUCGUCAAGUUUUCAUGAGCCGGUCACCAAUCGUUCAGUUUCAACCAGGACGGUUCAUAUGCUUCACACUUUCCGCGUCAAGCGCUAUAGUGAG UUUUGUUCUCAGGGCGGGGCGAAAUUCCCCACCGGCGGUAAgacgaaucaucagauaugacuaguu.........GAGCCCGCGA.GCgccaccaacuagcaaugg.........................................UUUGUGGGUCAGCAGA.UCCGGUUAAAUUCCGGAGCCGACGGuCAUAGUCCGGAUGCA.AGAGA.ACCGUGGUUUCGCUGAUU
............................................................................................................................................................................................ ......<.<<.<<<<..<<............>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>............... ............
L09228.1 0.00 .AAACAUCACCUUUCGGAUCGAAGGGUGAUGUUUUGUUUUUCUCAAAUUGUAAGUUUAUUUCAUUGCGUACUUUAAAAAGGAUCGCUAUAAUAACCAAUAAGGACAAAUGAAUAAAGA UUGUAUCUUCGGGGCAGGGUGGAAAUCCCGACCGGCGGUAGuaaagcacauuugcuuua................GAGCCCGUGA.CCcgugugc....................................................AUAAGCACGCGGUGGA.UUCAGUUUAA-GCUGAAGCCGACAGuGAAAGUCUGGAUGGG.AGAAG.GAUGAUGAGCCGCUAUGCAAAAUGUUUAAAAAUGCAUAGUGUUAUUUCCUAUUGCGUAAAAUACCUAAAGCCCCGAAUUUUUUAUAAAU
..................................................................................................................... ......<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>..>.............. ...................................................................................
M64472.1 0.00 .GAAUCC GCUUAUUCUCAGGGCGGGGCGAAAUUCCCCACCGGCGGUAAaucaacucaguuga....................AAG-CCGCGA.GCgcuuugggugcgaa.............................................CUCAAAGGACAGCAGA.UCCGGUGUAAUUCCGGGGCCGACGGuUAGAGUCCGGAUGGG.AGAGA.GUAACGAUUCUGUCGGGCAUGGACCCGCUCACGUUAUUUUGGCUAUAUGCCGCCACUCCUAAGACUGCCCUGAUUCUGGUAACCAUAAUUUUAGUGAGGUUUUUUUACCAUGAAUCAGACGCUACUUUCCUCUUUUGGUACGCCUUUCGAACGUGUUGAAAAUGCACUGGCUGCGCUGCGUGAAGGACGCGGUGUAAUGG
...... .......................................................................................................................................................................................................................... ..<..<<..<<....<<.............>>..................................................................................<.......>.................>>..>>..>.............................................
U27202.1 0.00 .AUCAAUGAAGGAGGUUUUGAUUAUGUGAUUUCAGAGUGUGAAACCUGUAAAUGGCAGAUUGAUAUGUCGAGCAAUGUGACUUGUUUACAUCCGAUUACUUUAUUAUCAAUGGCAUUGGAUAAACGCUAAUUCUUGCUUGACUUUGACAAUCAAAAGUCGCAAAUUUGCAACAAUUUUUU AAUAAUCUUCAGGGCAGGGUGAAAUUCCCGAUCGGCGGUA-..................................AAGUCCGCGA.GCcgaacga....................................................AAAAGGUUUGGCAGGA.ACCGGUGAGAUUCCGGUACCGACAG.UAUAGUCUGGAUGGA.AGAAG.AUGAAAUUACCGUGUAAGCGGUGGUUU
................................................................................................................................................................................... .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. .....................
U32760.1 0.00 .GACUUUUUUCUCUUUUGUUUUUGACAUAAUCUGCUCUUGAUAGCGUAAGAAUUGAGUGUGUUUAUUGUAGGCUAAAUGAAAAUAUUUUUCACGUUCUGAUUUAGUGCCUAGGUAUUUUGCGUUAUACUUAGC UCGCAUUCUCAGGGCAGGGUGAAAUUCCCUACCGGUGGUA-..................................AAGCCCACGA.GCguuuaaaagugcggucaauuuuuggcaaauuuuuccugcgaaauuguccugauuuucacUUUUAAAGUCAGCAGA.UUUGGUGAAAUUCCAAAGCCGACAG.UAAAGUCUGGAUGAA.AGAGA.AUAAAACGAGUUGGGUUCCCAAAUCGUUUAUUUUAUUUGCAUUUCUCAGCCCUGAUUCUGGUAUUUAAUUGAAA
.................................................................................................................................... .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. ....................................................................
X51510.1 0.00 .UGAUGUUUUGUUUUUCUCAAAUUGUAAGUUUAUUUCAUUGCGUACUUUAAAAAGGAUCGCUAUAAUAACCAAUAAGGACAAAUGAAUAAAGAU UGUAUCCUUCGGGGCAGGGUGGAAAUCCCGACCGGCGGUAGuaaagcacauuugcuuua................GAGCCCGUGA.CCcgugugc....................................................AUAAGCACGCGGUGGA.UUCAGUUUAA-GCUGAAGCCGACAGuGAAAGUCUGGAUGGG.AGAAG.GAUGAUGAGCCGCUAUGCAAAAUGUUUAAAAAUGCAUAGUGUUAUUUCCUAUUGCGUAAAAUACCUAAAGCCCCGAAUUUUUUAUAAAUUCGGGGCUUUUUUGACGGUAAAUA
............................................................................................. .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. ...........................................................................................................
X95955.1 0.00 .AUUUCAGCAAAUCGAACCGGAUUGACGGCUUAUUGAAGGUCGUUAAAGUAAACGAAUAAAUGAAGGCGCCCUUUUUGGUAAAAAAAGGCCUUUUUAUUUUUUCUGAAUAAUUAGGUGCAAAUUCAUUGCGCCUCCCGUAAAGGAUGUUAUAAUAGCGGAUAAGGACAAAAAAAUAUUGAU UGUAUCCUUCGGGGCUGGGUGAAAAUCCCGACCGGCGGUAAuaaggcgcuccugcgcuuua..............CAGCCCGUGA.CCcguaugc....................................................AUCUGUAUACGGUGGA.UUCAGUGAAAAGCUGAAGCCGACAGuGAAAGUCUGGAUGGG.AGAAG.GAUGAGAGAAGCUAUGCAAAAAAUAA
.................................................................................................................................................................................... .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. ....................
Z99116.2 0.00 .AACUAAAUAUCUGAUAAUUUAACAUAUUCUCAAAAGAGUGUCAACGUGUAUUGACGCAGUAAAGGAUAAAAGUAAAGCCUAAUAAAUCAAUGAUCUGACAGCUUGCAGGUAAUAUAUUUAAUUUGAAGCAAUUCUCUAUACAGCCAACCAGUUAUCGUUUAUAAUGUAAUUAAAUUUCAUAUG AUCAAUCUUCGGGGCAGGGUGAAAUUCCCUACCGGCGGUGAugagccaauggcucu...................AAGCCCGCGA.GC...........................................................UGUCUUUACAGCAGGA.UUCGGUGAGAUUCCGGAGCCGACAG.UACAGUCUGGAUGGG.AGAAG.AUGGAGGUUCAUAAGCGUUUUGA
....................................................................................................................................................................................... .....<<.<<.<<<<..<<<..........>>>...................................................................................................................................<<<<<.......>>>>>.............>>>>.>>.>>.............. .................