Seq ID Score (bits) Sequence
AB008757.1 0.00 .UAUCCAUCAAUGUUCGUCUUUUUUAGUAAAAAAUGCUUCUCAACCGCUGUCGCUCAUGGUAUACUGCUAAUA AAUGAAUCACGCUGACUCACUCAUAUAAUCGCAAGAAUACGG.CUUGCGAGUCUCUACCAGCCGACCGUAAAUCGGCUGACUAUGAGUGGCAAUGUCAGGA---GGGAGGCGGUCAUGG
........................................................................ .......................<.............<..........................>.................>..................... ...............
AE006347.1 0.00 .UUUAGCAUU UAGUCUAUAAUAGAACAAUCUUAUUUAU-ACCUAGGAUAUGG.CUGGG-CGUUUCUACCUCGUA-CCGUAAA-UGCGAGACAAUAAGGAAAUUCGAUUUUUUAGUAAAUUUAAUUUCUUUUUUGCGUAUUUGAAACGUCUUGUUAUUUUUUAUAACGAGACGUUUUUCUCACCUGUGGGCACAGAUGAGAAAAAAUUUUUUUAAGGAGAGAAUAAUGAAGUUAUUAGAAGACCGCAUUCAUACAGACGGUCAAGUAUUAGGACAAGACAUUCUUAAAGUUGACCGCUUUUUGACA
......... ........................................................................................................ ..........................................<.............<.........................>...............>............................................................................................
AE007476.1 0.00 .CUGUUAGCUUACAAUGGAGUUUUUGUUCACCCUCUCUUCUUUUUGUUCGUUUUUUAAACCAAAACACUAACAAAAUAGUUGAUUUCUAAAGUUAUUUAGUGUAAAAUAAAAACAUUGGCUCAAGCCUAUUU AAAAUUGAAUAUCGUUUUACUUGUUUAU-GUCGUGAAU-UGG.CACGA-CGUUUCUACAAGGUG-CCGG-AA-CACCUAACAAUAAGUAAGUCAGCAGUGAGAUAUGGCCGUUUUUGCCAUGUCUAUUUAGGGGACUUACUUAGAGAUUAAGUAGGUCUUUUUUUAAUAUUUC
................................................................................................................................... .....................<...............................................................>.................. .....................................................................
AE007602.1 0.00 .UAAAUGUGAAUGUGUAAAUAAAUAUGUUAUAAUCGUUAAGUAAGGGAUAUAAUAGUUAAAACUAACUUAUUUCCC UAUAUAAAAAACUAAAUUUCUCGUAUA-CACCGGUAAUAUGG.UCCGGAAGUUUCUACCUGCUG-CCAUAAA-UAGCAGACUACGGGGUGUUAUUGAUAAUAUAAUAAUAUUUUAUCUAUAUACCUCAUUAAUACGGAAAUUAAAAUAUUGACUAUGUAUGAAAAUUUAGCAAGCUUUUGCAAUUUGAAGUAUACAUUAGUUGUUUGUUUCCAUAAAUUAUGAGGUUUU
........................................................................... .................................................................................................<...... .......<........................>.................>..........................................................................
AE007768.1 0.00 .AAUGAUUGACAAAAUGCAUUUUUUUAAAUAAAAUAGAAGUUAAAAU AAUCGUUAAUAUAGUUUAACUCAUAUAUUUCCU-GAAUAUGG.C-AGGAUGUUUCUACAAGGAA-CCUUAAA-UUUCUUACUAUGAGUGAUUUGUUUGUAUGCAAAAGCAUGCUGAUUUUCACUCUGAAAAUUGGUGUGCUUAUGUUCUAAAUAAAAGGUUUCAUAAAAUUCUGUAUAUUUACCCUAAAGUGACUAUAUUAGUUAUAAAUAUUUUUGAAAGGAAGUUUUACAAAUGGCAAAAAUUCUAAAACAAGCUU
.............................................. ........................................................................................................ ............<.............<............................>.................>................................................................................
AE007775.1 0.00 .UUAAAAAAAGUGUGCAAAAUUUCAUAAAAAAUUUAAAGAAAUGUUGCUUUUGAUAGAAAAAUGGUGUAAUAUAAAUCUGUAAUAAUUGAAUAGU GAAAAGUAAUAACAUAUUACCCGUAUAUGCUUAGAAAUAUGG.UCUAAGCGUCUCUACCGGACUGCCGUAAAUUGUCUGACUAUGGGUGUUUAUAAGUAUU---UUAGAUAUUUAUAAGCUCCAUAAUUUUUUAUGGAGCUUAUUUUGUUUUAAAAUAGUUUUAAGGUUAACUUUUGUAUAACACAUAUAUAGCUAAAUCAUUUUGAUGG
.............................................................................................. .......................<.............<..........................>.................>..................... ..........................................................................................................
AE010606.1 0.00 .CAUUUUUUCAAUUAAAUUUCUAUUUCAAUAAUUUUAUUUCUUUAGCUAUUUACAAAAGUAAAUAAAUAGUGUAUUAUAUUUA UAAAUAAUUUUAAUAAAAAUUCGUAUAA-GCCUAAUAUAUGG.-AAGGGUGUCCCUAC-GGUUAACCAUAAAUUAACCAGCUACGAAAAAUGUUUUACUGUGUUUCUUUUUUAAUAUGGAAAUAUAUUUUUUGUAUGCUUAACAAAAAGGAGGAAACAGUGAAAUUAAUAACUAAAAAAAAUUUAAAUAAAAUAAAAUUUAAGGUAGCUGUUUUCUACGGGA
.................................................................................. ....................................................................................................<... ..........<.........................>..............>..................................................................
AE013027.1 0.00 .UCUCUACCAGCAUUACGAAUGAAGUGCCGGGAGUUAACAGGGUUUUAUACGAUAUAACUUCAAAGCCUCCUGCUACUAUAGAGUGGGAAUAAAAACGAACAUUAAAAGAAAUUUCUUUAAAAAAAUUCGUAGUAUCUAUUGACUUUUUGUUAAAUAGUUGCUAAGAUAUAUUUAG AAAAAUUUAAUAAGAAGCACUCAUAUAAUCCCGAGAAUAUGG.CUCGGGAGUCUCUACCGAACAACCGUAAAUUGUUCGACUAUGAGUGAAAGUGUACCUA---GGGUUCCAGCCUGGCAACAGGCGUU
............................................................................................................................................................................... .......................<.............<..........................>.................>..................... .........................
AE014152.1 0.00 .UAAAUGAUAUGGAGUUAGCUAGGACCAGUAAAGCAUUUUUUAGCUUAAUGCUGGAGAUGCUUUUAUCAUAUCUCUGUAGGUAUUGAAAAAAAUAAGAAACAUGGUAAGAUAGUAAAUUAUCAUAA UGAAUUCAAUAAUGACAUACUUAUUUAU-GCUGUGAAU-UGG.CGCAG-CGUCUCUACAAGACA-CCUU-AA-UGUCUAACAAUAAGUAAGCUUUUAGGCUUGCUUGGUUUUUAACCUUGCAAAGCGAGAAACUCUUAUAGUUUCUCACUUUGCGGCAGGCUUUUUCUAUUUGAAUCAA
............................................................................................................................. .....................<............................................................>..................... ...........................................................................
AE014241.1 0.00 .GUGAUUCCAUUUAAAUUAAAUCUUGAAAUCUUAAUUAAAAAUGUUACAAUAGUUAUCUAUCAUACAUAA CAAUUAAAUAUAUGAUUUACUUAUUUAU-GCUGAGGAU-UGG.CUUAG-CGUCUCUACAAGACA-CCGU-AA-UGUCUAACAAUAAGUAAGCUAAUAAAUAGCUUGCCUUGUUGGUUCAUGUUAAUGAAGCGAUAAAUUAGAGGAGAUUUGUGUCCUCUGAUUGAGGUAAGUUAUUUUUUUAUUUUCUAAAGAGUGAAGGGGUUAUUAUGAAGUUAUUGGAAGAACGUAUUCUUA
..................................................................... .....................<............................................................>..................... ...................................................................................................................................
AE015944.1 0.00 .ACCUAUUUUAAUAAAUAAAAUAGUGUAAAUAAGCAAAAGUUUUAAAUAUAUUUUGGUAUAAAUAUAUAGAACUUUAGAAUGUAAAAUUUAAAAAAUGUUUUUAAUUAAG CUCUAUAAUAAAUUAUUGACUCAUAUAUCCCCU-UAAUAAGG.U-AGGGAGUAUCUACCAGAAG-CCUUAAA-CUUCUGACUAUGAGUGAAUAAAGCAUUGUCAUAGUUAAACGUGCUUAUUCACUUAUGUUCAAGAAGUAAGCAUGUUUUUUUGUACUUUAAAAUCAUUAAAUAUAAAAAGGAGUUGGAUUAAA
............................................................................................................. .......................<.............<.........................>..................>..................... ...........................................................................................
AE016809.1 0.00 .AAACAUGGGCGUGAAACAUACAGAGUAACCUUUUUGAAAUAAUUUGUUUCAUUCUAGCGGUUUGUUGAGCGUUUCCAAUCAACAGAUAUCGAUAGAGUCUAUCAAAAAAAUCGAAGAUCCCGAUGAAAAAGCCUCUUUUGUCACAUUGCUGAGGCGAAAAACAGGUGCUAG -ACUUUCGGCGAUCAACGCUUCAUAUAAUCCUAAUGAUAUGG.UUUGGGAGUUUCUACCAAGAG-CCUUAAA-CUCUUGAUUAUGAAGUCUGUCGCUUUAUCCGAAAUUUUAUAAAGAGAAGACUCAUGAAUU
........................................................................................................................................................................... _......................<.............<.........................>..................>..................... .............................
AF270087.1 0.00 .AAAAUACAACAAAAAUUUGCUAUUAUCAU ---AAAAUAAUUUAUAUGACUCAUAUAAUCUAGAGAAUAUGGcUUUAGAAGUUUCUACCGUGUCGCCAUAAACGACACGACUAUGAGUAACAAUCCAAUACAU-UAAGAGCAGUUUAAAUCGCUAAAGCAACAUAAAAGUGAAACGCAUUUGGUAUAACUGGUAACAAAUGAGGAUACACAUAAGCCUGUAUAAAUUGAGUGCAAUUGUUUAAGUUUUAUCAAAUUUAAUAAGCGUUUUUAGGAUUACGUAUGCGUAUCUUCUUCUUAAUUUGCU
............................. ___..................................................................................................... ...................................<...............................>.......................................................................................................
AL591975.1 0.00 .UCCAACUAUUAUUUGUUUUUAUUAUACCUUAUUUAUUUAAAAGUAUAAACUUAUUUAUUUAAAAGUUCGUUUUUAAUUUUUAUUUCUUACACGUAUUGCCAAAAAUCGGCU AAUCCGCUACAAUAAUAUAGUCGUAUAAGUUCGGUAAUAUGG.ACCGUUCGUUUCUACCAGGCAACCGUAAAAUGCCAGGCUACGAGCUAUUGUAAAAUUU---AAUAGGGAUUUUUUUGCUAUUUUUAUUUAUUAUUCCCUUUUUUACCUAGGCUCUUUCCGUUAUGUGCGACAACAUAAAUAGGGAGGCUU
............................................................................................................... .......................<.............<..........................>.................>..................... .........................................................................................
AL591981.1 0.00 .AAUAAACAAC AUAACUUAAAACCGAAAUACUUGUAUAAUAGUUGCGAU-UGG.GCGACGAGUUUCUACCUGGUUACCGUAAAUAACCGGACUAUGAGUAGUUUGUAUAAAGA--AGUCACUCCGAAAAUUGGUGGCUUCUAUACUGCUUCUCUAUUUUUAGAGAAGCAGUUUUUUUAUUUUGAAAGGAGAAUCGUUUUGAAAUUACUGGAAGAGUUUAUUCAAGAAAAAGGUACGGUUUUACCGGGGAAUGUUUUAAAAGUAGAUGCUUUUUUAAAUCACCAAAUUGACCCGGUUUUAAUGCAA
.......... ........................................................................................................ ............................................<.............<...............................>.................>.................................................................................
AL596165.1 0.00 .GAAAUUUAUAAGUCAUUUUUUUACCUCCAACUAUUAUUUGAUUUUAUUAUACCUUAUUUUUUUAAAAGUAUAAACUUAUUUAUGUAAAAGUUUGUUUUUUAUUUUUAUUUCAUUCAUGUAUUGCCAAAAAUCGGCU AAUCGUCUACAAUAAUAAAGUCGUAUAAGUUCGGUAAUAUGG.ACCGUUCGUUUCUACCAGGCAACCGUAAAAUGCCAGGCUACGAGCUAUUGUAAAAUUU---AAUAGGGAUUUUUUUGCUAUUUUUAUUUAUUAUUCCCUUUUUUACCUAGGCUCUUUCCGUUAUG
........................................................................................................................................ .......................<.............<..........................>.................>..................... ................................................................
AL596170.1 0.00 .UGACCCUGCUCCUUUAGAAAGCUAUAAUAAACAAC AUAACUUAAAACCGAAAUACUUAUAUAAUAGUUGCGAU-UGG.GCGACGAGUUUCUACCUGGUUACCGUAAAUAACCGGACUAUGAGUAGUUUGUAUAAAGA--AGUCACUCCGAAAAUUGGUGGCUUCUAUACUGCUUCUCUAAAUUUAGAGAAGCAGUUUUUUUAUUUUGAAAGGAGAAUAUCUUUGAAAUUACUGGAAGAGUUUAUUCAAGAAAAAGGUACAGUUUUACCAGGGAAUGUUUUAAAAGUAGAUGCAUUUUUAAAUCA
................................... ........................................................................................................ ............................................<.............<...............................>.................>........................................................
AP001509.1 0.00 .AAGAAUGCUGAUAAGUUACCUUACAAAUGAAUGGUUUCUCGCCUAAAAUCAUCAUAUACUAACGGUAAC UUAAUCGAGCUCAACACUCUUCGUAUAUCCUC-UCAAUAUGG.GAUGAGGGUCUCUAC-AGGUA-CCGUAAA-UACCUAGCUACGAAAAGAAUGCAGUUAAUGUGUUCUUUUGUGGCUAGGUUUUUUGCGCGUUGAGGAACAUGAUGUAUUGGCUAUUUAGAAAGCGAAUGCUUGAGGAGGGCUUUUAUAUGACAACGAUCCUAAUUAAACAGGCAGAGAUGGUAACCAUGAAUC
..................................................................... ........................................................................................................ ............<.............................>........................................................................................
AP001512.1 0.00 .GCGCUUUUGCUAUGGUUUCAAACGUCAUUUCUAGGCAAAACACGAAUAAAUUUUCUGAAUUUAAUUCAUUCAUUCGUUUUUUCCUGCAAAGGGGUUUUCAUUGACGACAGAAUCCUAUAUAAUGCCAUCAUACA -UUUACAUUAAAAAAAGCACUCGUAUAAUCGCGGGAAUAGGG.CCCGCAAGUUUCUACCAGGCUGCCGUAAACAGCCUGACUACGAGUGAUACUUUGACAUA--GACUAGUCAUGCCAUUUUGGACCGAACGUCAAGGUUUCACUCGCUUAUUGAGUGUGCCAGAACGUU
...................................................................................................................................... _......................<.............<..........................>.................>..................... ..................................................................
AP003130.2 0.00 .GCAUUAAACGUCUCUGUACAUUUAUAAAACUAUUAAAAGAUUACCUAAGCAGUUAUUGAAAAAAUGCCGAAAAUUUGCUAUUAUCGU --UAAAUAAUUUACAUAAACUCAUAUAAUCUAAAGAAUAUGGcUUUAGAAGUUUCUACCAUGUUGCCUUGAACGACAUGACUAUGAGUAACAACACAAUACU--AGGAGUAGCUUCAGCCAUUAAAUUGUAACCAUGGUGGGUGAUUUAUAUCAUUUUAUAUGAUGGUCACAGUUUAUUUGAUGAAACUUCUUUUACAUUGAUUGCAUGACAAAUUC
....................................................................................... __...................................................................................................... ..................................<........................>.....................................................
AP003186.2 0.00 .AUGUUUCAUUUCUAAGAUAUAAUAAACUAAAUAGGUUAUUUAAUGUUUCUUAUGUUCAUUAAAAUUUUUUUAGUGAUAAAACUUUACAUUGAAAGAAUAAGUAGUUAUAAUACUAUUUAAUAACUUAAUA UGUACUUAUAUAAGUAUA--UCGUAUAUGCUCGACGAUAUGG.GUUGAGUGUUUCUACUAGGAGGCCGUAAACAUCCUAACUACGAAUAUAUAGGUGAUUUC--UAUAUUUUUUUGUGAGAUUAUUAUAUAUUCCUAGGCUUUUUGGCUUAGGAAUUUUUUUAAUUCAUAUAAA
.................................................................................................................................. .......................<.............<..........................>.................>..................... ......................................................................
AP003193.2 0.00 .UGUAUGUAUUAAUAUGAAAAGUACAACUAAUAAGUAUAUACUAUAUUACAUGAAAAUAAGUGAAUUAUUUCUUGCAAAGAAUAUAAAAUAUGACGUUUAAAAAUCAGUUGUGAACUUUUGAGAUUUAUUUUAUGCAUUUUGUUGACAAGCUUUCUUUCAUAGAUUAUAAUAAAUAAAAAUUAAAC AAAACGGAAUAUAAACAAACUCGUAUAA-GCUUUGAAUAAGG.-CAAGGCGUUUCUACCGGAAA-CCUUAAA-UUUCCGUCUAUGAGUGAAUUUGAUAUACUAUAGGUGUACUAUAAGC
...............................................................................................................................................................<......................... ......................................>................................................................. ...............
AP003194.2 0.00 .UUUAUAGAAAAAUCUAUGCAAUGUAUUUUAUAUAUUAUCUUAAUUAGAUAAAAAUUUAAUACAUGUGCAUAGAUUUUUAUUUUUACUUUGAAAAUCAUUCAAACUUUUGUUAAAAAUUUAUUGUUGACUAUAAAUUUUUAUAUGGUAAAAUAAA -UAAAAAAAUAAAUUUUGCUUCGUAUAACUCUAAUGAUAUGG.AUUAGAGGUCUCUACCAAGAA-CCGAGAA-UUCUUGAUUACGAAGAAAGCUUAUUUGCUUUCUUCGUAAUCAAGAAUUUUUUUUUGAACCUUUUUUAGGAUAUAUAA
.......................................................................................................................................................... _......................<.............<.........................>..................>..................... ..............................................
AP004595.1 0.00 .GUGGUCGACAAUGAUAGUAAUAUAA UGAUGUAAUUGAAUAGAAAUGCGUAUAAUUAAGGGGAUAUGG.-CCCACAGUUUCUACCAGACCACCGUAAAUGGUUUGACUACGCAGUAAUUAUAUUUGUA--UCUAGAUUUUAAGAUAUGCAGAUAUAUUUCCUGUAGUUAUUGUAGAAGCGCAUGGCAAUCCCAAGUGCUUCUAUUAUUUUUGGGGGGAAUUAGAUAAAUGAACAAGUAUUUUCAGUUAGAUAAGUUAGGUACAAACAUUCGAAGAGAGUUUGUUGCAGGCUUGACUACUUUCUUA
......................... ........................................................................................................ ....................................<.............<...............................>.................>..........................................................................
AP004596.1 0.00 .ACUGAAUACAUUCUUCAUCUUGA -AACCUUAUAUAUAGUUUUUUCAUAUAAUCGCGGGGAUAUGG.CCUGCAAGUUUCUACCGGUUUACCGUAAAUGAACCGACUAUGGAAAAGCGGAAAAUUCG--AUAUUCUAUCUAUCAAACUCAAAGACUAUCGUUUUUAAAUUUUCGACAUUUCAAGCUCGGAAAUCUGCUUUUUUAUAGGCGGAUUUUCGAGCUUUUUAUAUUUUAGGAGGAAUGGAAGCAUGGAGUUACUAAAGAAUAAAAUCAUCGAAGAAGGAAGAGUGUUGUCGGAUACUGUGU
....................... _....................................................................................................... ...................................<.............<...............................>.................>.............................................................................
U51115.1 0.00 .AAAUGGGUCAAUUCAGAUCGUUCCGUGCGGGAAAAAAAUCGUAUUUGAAGGGAAAUUGAUCUAAAACACGAACAUUAGUAGAAUGAAUUUUUGUAUCGUUCGAUAAUAUCGUUGACAUUAUCCAUGUCCGUUGUUAAGAUAAACAU ---GAAAUCAAAACACGACCUCAUAUAAUCUUGGGAAUAUGG.CCCAUAAGUUUCUACCCGGCAACCGUAAAUUGCCGGACUAUGCAGGGAAGUGAUCGAUAAAACUGACAUGGAUAUAUCGCAGAAGCGAACGACUGACGAUACAUGUACCAUGCCC
.................................................................................................................................................. ___....................<.............<..........................>.................>..................... ......................................................
X83878.1 0.00 .AAUUAAAGUUCGGGAAUUUUUAUUUUCAGCCUAUGCAAGAGAUUAGAAUCUUGAUAUAAUUUA UUACAAUAUAAUAGGAACACUCAUAUAAUCGCGUGGAUAUGG.CACGCAAGUUUCUACCGGGCA-CCGUAAA-UGUCCGACUAUGGGUGAGCAAUGGAACCGC-ACGUGUACGGUUUUUUGUGAUAUCAGCAUUGCUUGCUCUUUAUUUGAGCGGGCAAUGCUUUUUUUAUUCUCAUAACGGAGGUAGACAGGAUGGAAGCACUGAAACGGAAAAUAGAGGAAGAAGGCGUCGUAUUAUCU
............................................................... ........................................................................................................ ..........................<........................>.....................................................................................
Z99107.2 0.00 .AAAUAUAAUCAUAUUUUUUUCCGGUUCACCGUUUUAUAAAUUUUUCUAUGGAAGAUUCAUUCAUAAUGUGGUACACUCAUCAACGGAAACGAAUC AAUUAAAUAGCUAUUAUCACUUGUAUAACCUCAAUAAUAUGG.UUUGAGGGUGUCUACCAGGAA-CCGUAAA-AUCCUGAUUACAAAAUUUGUUUAUGACAUU-UUUUGUAAUCAGGAUUUUUUUUAUUUAUCAAAACAUUUAAGUAAAGGAGUUUGUUAUGAAUUUCAAAGUUUUCCUGCUUGCAGCUUCUACGAUUGCAGUCGGAUU
............................................................................................... .......................<.............<.........................>..................>..................... .........................................................................................................
Z99123.2 0.00 .UACUGACAUGCUGGUAUCCCGCCAACAUCAUAUCAGCAUAGCAAUCCAGCAUGUUUUUCCUUUAUUUUCUCAUUUUAGAAUAUAAAUUUUAUUAUUGUGAAAAUAGUUAAAAAGGUUGAUUUUCAAAAAGUGAAAGGAUAAAAUACUGCUAUCAU ---CUUAGAAAAAGACAUUCUUGUAUAUGAUCAGUAAUAUGG.UCUGAUUGUUUCUACCUAGUAACCGUAAAAAACUAGACUACAAGAAAGUUUGAAUAAAUUUGAACGAGUUGAAAAGGACAAGUUCUUUUCUGUUUGCUCUUAUUUU
........................................................................................................................................................... ___....................<.............<..........................>.................>..................... .............................................