Seq ID Score (bits) Sequence
AC078832.7 0.00 .AAUCCUGUAUAUUACAAGUUAGUUAAAAUAUUA AAUUGAGUUAGAGGUuGCAUGUUUA.AUUAGUA..ACUUGUCAGaaguauuu..AUGGUACAUAAGU.UG......-AACAAGU.GAAAGG.UAA.AGAUGCCGAAAUAGAUAUAAAc...CAUA..aAUUAUAUC.UAUUGGGACAG.UUUUc..GAAUaGGAA.CUGUACUGUCACA--....GAA....................--UGUGAUGUGCUACCUUAUAUAGAUAAUUGCCAAAGUGGUUGCAUAUCUUAAAGGUAUGUAGCCACUUUUUUACUUUUAAUAUCACUAUGUUCUGUAAAAAAGGGUAUGAAAGUGAAUAAAGGUUAUUUAUUUCUUGGCCUCUAAAACAUGGAAAGGGAGCUUAUAUGUCAAAAGUUCAAAAUGAAAG
................................. ..........<..<.<...........................................>............................<..........>.>><.<<<<.....<...............>......>>>><..<<<<....<.........>...>>>>.>...>...................................................... ............................<.....................................>....................................................................................................
AE000476.1 0.00 .CGCCAGGAGUGGAUGAAAAAUCCGCAUGACCCCAUCGUUGACAACCGCCCCGCUCACCCUUUAUUUAUAAAUGUACUACCUGCGCUAGCG CAGGCCAGAAGAGGC.GCGUUGCCC.A--AGUAacGGUGUUGGA..........GGAGCCAGUCC--.UG....ugAUAACACCuGAGGGG.GUG.CAUCGCCGAGGUGAUUGAACGgcu.GGCC..aCGUUCA-U.CAUCGGCUACA.GGGGcu.GAAU.CCCC.UG-GGUUGUCACCAGaagcGUUcgcagucgggcguuucgcaaGUGGUGGAGCACUUCUGGGUGAAAAUAGUAGCGAAGUAUCGCUCUGCGCCCACCCGU
.......................................................................................... .......<..<.<...................................................>.......................<..........>.>><.<<<.....<................>.......>>><..<.......<........>.......>.>...>...................................................... ...................................
AE001799.1 0.00 .AAUUUUGAUAAAUAAAUUUUUGUCUAACUUCAAACCCCUUAUCGAUUGUCACUUCAAAGUUAACCUUUCCUUAAUUGUCUUCGGUUUGAAAUACUGAUACAAUUAAGCUAAAAUAGUCAUU GACCCGA-CGGAGGC.GCGCCCGAG.AUGAGUA..GGCUGUCCC..........AUCAGGGGAGGAA.UC....ggGGACGGCU.GAAAGG.CGA.GGGCGCCGAAGG-GUGCAGAGuuc.CUCC.cgCUCUGCAU.GCCUGGGGGUA.UGGG...GAAUaCCCA.UACCACUGUCACGGAgg..UCU...................cUCCGUGGAGAGCCGAUCGGGUCUGGAAUCAGAAAAAGAUUUCAGACCUGAUUUGGCGUCUCUUCGGGGAGCGAAGAGACGCUUUUUUUAUUAAUUCAAGGA
......................................................................................................................... ...............................................................................<.........>.......<<..........<....................>........>><..<<<<..................>>>>.>.......................................................... ...................................<......................................>....
AE004127.1 0.00 .CUUGUCACACUAAUGUCAUUUUUAUUUGCACUUUUAGAACAUUUUGUCGUUGACAAGAUUUCGCCAACACCGUUCAAUGUGUGAGCUA UCUAGCAGAAGAGGA.GCACUGCCC.A--GGCA..GAUGUUUUGugga......GCCUCAACUCCAA.UA.....cAGAACAUU.CAGGGG.GAG.UAGUGCCGAGGUGAAUCAAAGu...UGUG..gCUUUGGUU.UAUCGGUUGAA.CGGGcu.GAAU.CCC-.UUCAACUGUCAUCAGcuc.GAA...................uCUGAUGAAGAGCUUCUGAGGGAAAUCUUUCUAUAGUCACUCCUCUAUUUUGCUCUAUAAAAAACACUCUCUUCACAACAUUGGACGUUGGGUUACCAACAACUCGUUUUUCAGGAAGUCUGGGAGAAUUGCCGU
........................................................................................ .......<..<.<..................................................>........................<..........>.>><.<<<<....<................>......>>>><..<<<<....<........>....>>>>.>...>...................................................... .............................<.....................................>............................................
AE004193.1 0.00 .GUCUCUCACCUAAUGCGAAAAGCAGACUAAAUGAGCCAAAUGAAUUGGCAGAUUAGGAUGAAGU UUUCGCCGUAGAGGA.GCGGUUACG.AAAAGUA..UCCACAGUU..........GGGGUGAUGCCAA.UG.....aAUUGUGGA.AAAAGG.CGU.UGCCGCCGAAGUCAACUUGCCc...AUCA..aCGC-AGUU.GGCUGGGGUUA.CAUU...CAAUaGGUG.UAACACUGCCAUAGUc...UAU.........auuguuguuaaACUAUGGAGCGCUACUGUAGGGUUGGGUGAAGUGUUCGCUUCCCUUUCGCUUAGUUCAACAUAAAUUAAGUUGACAUGAUGUCGCUUGAUUUGUCUGCAGUAGAUCUCUAACCAUUUUUUACUGGUUUAGGAAGAUCAUGAAUUUAAUCGAUUUUGCU
................................................................ ..........<..<...........................................................................<.........>.>><.<<<<............................>>>><..<<<<...<..........>...>>>>.>...>...................................................... ........................................................................................................................................
AE004361.1 0.00 .GGUGAGAAAAUUCUGACCCUUUAGCGAAUAUACCGGAUGAGAUCAAUUUCACUGCAGAAAUGGGGAAAUUAAAUCUUGUCGUCACCUGAAAAGGCAGUAAUAUACGUCGUGUGUCACAGUUUCUGAGCCUAGCUCUUCGACGGGCACAAGUU CCUUUAAGUAGAGGC.GCGCUGUUC.AUGAGUC..GCCAGUCGU..........AGGUUGACCCCGA.UG.....aUGACUGGU.UAAAGG.GUA.CAGCGCCGAAGUGAUCGUUGC....GUCA...UCAACGUU.CGCUGGGCCAG.CAUU...GAACaAAUG.CCGGACUGCCAUAGUg...UGU..................ugUCUAUGGAGCGCUACCUUGAAGGAUAAGAAGUGUUAUUUCGCUGAAAUGUGUUUUUUAUCCUGCUGGUAG
........................................................................................................................................................ ..........<..<...........................................................................<.........>.>><.<<<<............................>>>><..<<.<...<..........>...>.>>.>...>...................................................... ................................................
AE005635.1 0.00 .CCCGCUCACCCUUUAUUUAUAAAUGUACUACCUGCGCUAGCG CAGGCCAGAAGAGGC.GCGUUGCCC.A--AGUAacGGUGUUGGA..........GGAGCCAGUCC--.UG....ugAUAACACCuGAGGGG.GUG.CAUCGCCGAGGUGAUUGAACGgcu.GGCC..aCGUUCA-U.CAUCGGCUACA.GGGGcu.GAAU.CCCC.UG-GGUUGUCACCAGaagcGUUcgcagucgggcguuucgcaaGUGGUGGAGCACUUCUGGGUGAAAAUAGUAGCGAAGUAUCGCUCUGCGCCCACCCGUCUUCCGCUCUUCCCUUGUGCCAAGGCUGAAAAUGGAUCCCCUGACACGAGGUAGUUAUGUCUGAAAUUGUUGUCUCCAAAUUUGGCGGUACCAGCGUAGCUGAUUUUGACGCCAUGAACCGCA
.......................................... .......<..<.<...................................................>.......................<..........>.>><.<<<.....<................>.......>>><..<.......<........>.......>.>...>...................................................... ...................<......................................>...................................................................................................
AE006126.1 0.00 .AAAUUAAGUUAAAAAUAUUCCCUUCUCUCUAUUGGCAAGGAUCACUUUUUAUUGUAGUCUUGUUGCCAUCC UACUUGUGUAGAGGA.GCGAUCACU.AUAAGUA..UUUUUUCU-..........GAGUGGAUAACGA.AG.....aGGAAAAAG.GAAAGG.AGU.GACCGCCGAAAUCAAUUGAAA....GUCA...UUUUGAUU.GGUUGGUGGCG.UAUUc..GAAA.GGAA.CGUCAUUGUCAUAGUc...UUU...............uuuaaACUAUGGAGCGCUACUGGUUGGGUCAGGUCUUAAUUAAUUUUUGCCUACCUUUUUAGAUCAUUUCUAUA
....................................................................... ..........<..<...........................................................................<.........>.>><.<<<<............................>>>><..<<<<...<..........>...>>>>.>...>...................................................... ...............................................
AE007576.1 0.00 .UAUAUAUAUUAAUA ACCUUUUGUAGAGGU.GCUUUAAGUcAAGAGUA..ACCGUUUGG..........AGUUGGCAAACUU.AG.....aUGAACGGU.AAAAGGgGCU.UUUAGCCGAAGCAUUUAGAUU....GGCA...GAUUUAUU.UGCUGGCUUUU.CAUA...CAACaUAUG.AAUGGCUGUCACUUUa...UUA.......guuaguuauuaggUAAGUGGAGCGCUACAAGGUACACAAGAUUGCAUUUAUUAGCGGCAAGGGUGUUCCUUUGCCGCUUAUUUUUAUAAAGAAUAUUGUGGCGCAAAAAAAGAUAAAGAGGUGUUUAAAGUGAAACUAUUUGGCAGCAUGCAUGAAGAGAACAACGAAUUAUAUAUAGGGGGGAUAAGCUCAAAAGAGCUCGCAAAGAAGUAUGGAACUCC
.............. ..........<..<..<...............................................>....................................>><.<<<<............................>>>><.<.<<....<..........>...>>.>.>...>...................................................... .............................<......................................>.....................................................................................................................
AE007843.1 0.00 .UUAAUUUAAAGUAUAGUGUAUACUAAAAAAAUAAGUGAAU AACUGAGGUAGAGGC.GCAAAAUUU.AAGAGUA..GAACUGUG-..........GAGACAAGCACUA.UG.....aAGCAGUUU.AAAAGG.AAA.UUUUGCCGAAGCG-UAUAGCUaaugCUUU.aaUGCUGUAC.UGCUGGGUUUG.UAUA...AAAUaUGUG.CAAAACUGUCACAAAg...UAU...................aAUUGUGGAGAACUAUCAUUGGUGUGGAAUUAACAACGUAUAUUUGUUUUAUUAAAUAUGUGUUUUAAUGCCCUGAGUGUAGUCUCAGGGCGUUUUUUAAUUUAUAGUAAAGUAUAAAAUGCGAAUAAUUACAUUUAGAUUUUAUGCUUUAGCUUGCCUUUAAUUUGCUAGUACGUGAAAAGG
........................................ .............<..................................................................................<........>.>....<<.......................>>..<..<<<<...<..........>...>>>>.>.......................................................... ........................<......................................>................................................................................................
AE007856.1 0.00 .CUUUAAAUAUGUGUAAUAUAUCGCUUAUAUGGUAAUACAUAUUUAGCCUUUUCCCUGCUUAUUGCCACACUUUACAAACUAUUUACUAAUAAAAAAUAUUACUAAAUUUCACUAUAUCAACUUGUAAACUGUUUUAAAGUUGAAACUUAAUUUAAUGUAUGAUAAACUAUUGAUAAAAUUAAAUUCUU ACCUAGGGUAAAGGU.GCUGUAGUU.AUUAUUA..UUUAUUCUU..........AGCUGGCAAGCUU.UG.....aGGGAUAAA.GAAAGG.AAU.UGCAGCCGAAGAAGGAUUUCC....GGCA...GGAACUUU.UUCUGGUUUUG.UAUA...AAAUaUAUG.CAGAACUGUCACUAUuc..UUU...................uAUAGUGGAGAGCUACAAGGUGCACGUGAGAUGUU
.........................................................................................................................................................<..<............................... ..........................<..........>.>>.<<................<.................>.......>>.<...<..<..............>.>.>.................................................................................................................. ............
AE013039.1 0.00 .UUGAUAAGCUUUACAUCAAAAAUAGAUAUUUUAAUAG CGCAUAAAUAGAGGA.GCUGCCAAGcAU--GUA..UUUGGCGAGguguuaaggaGAAGAACCUCCAA.UA.....cUCGCUGAA.GAA-GG.UUU.GGCUGCCGAAAGGGUGAGCUUg...UUCU..uGAGCUCAU.CCUUGGUGGUA.AAC-a..CAAA.-GUU.UACCACUGUCAUGGGa...CCU....................CCCAUGAAGCGCUAUUUAUGCAGUGAAAAUAUUUUCAUUGCAUAAAUAGCGCUUUUUUGUUAGAAAUGAAGAAAUACUUACAUGUCGAAAAUAUUUUCGGUGUUUUUGCUUUUAAUUUUACUCUCAAAGGGGGAGUAAGAUGGAUUUGAGGUUAAAAGGAUUACCUCAGGAAUUUUACCAAAAAG
..................................... ..........<..<.........................................................................<...........>.>><..<......<........................>.......>.........<.<..................>.>............................>..................... .............................................<......................................>..............................................................................
AE013149.1 0.00 .UUGAAAAUAUCUUGACAGCAAUUUUCACAAAUGAUAUGAUAGUAAAAAAAUCGAAUAAAAAUACCUCAUCUUCUUUGA AGGUGAGGUAGAGGC.GCGGGUCAUcAAGAGUA..ACAUGCCAGagg.......UGUUAAGGGCCGA.UG.....aAGGUGUGU.GAAAGGgGUG.-CCCGCCGAAGC-GCGUAAACuuc.CUUA.agGUUUACGC.AGCUGGGCCUA.UGCC...GAACaGGUA.UAGGACUGUCACUGAag..GCU..........ccccaggccuUCAGUGGAGAGCUAUCUCGCUACGGGGGAAGGAGGUAUUGCCUAUGUCUAUGAUGAAAAUAGACAGCUAAGGUAAUACUUGGCUGUAUUUUAUUUUGUCUUGCAAUUUUAUAAUUUAAAUUAUUAAAGUAAAUGAGGUUGAGAG
.............................................................................. ..........<..<..<..............................................>.........................<.........>.>><.<<<......<...............>.......>>><..<<<<...<..........>...>>>>.>...>...................................................... ..........................................................................................................................
AE015427.1 0.00 .UGUAAUGUUGAGUGUAAACCCUUAGCGCAGUGAAGCAUUUAUUAGCUGAACUACUGACCGCCAGGAGUGGAUGAAAAAUCCGCAUGACCCCGUCGUUGACAACCGCCCCGCUCACCCUUUAUUUAUAAAUGUACUACCUGCGCUAGCG CAGGCCAGAAGAGGC.GCGUUGCCC.A--AGUAacGGUGUUGGA..........GGAGCCAGUCC--.UG....ugAUAACACCuGAGGGG.GUG.CAUCGCCGAGGUGAUUGAACGgcu.GGCC..aCGUUCA-U.CAUCGGCUACA.GGGGcu.GAAU.CCCC.UG-GGUUGUCACCAGaagcGUUcgcagucgggcguuucgcaaGUGGUGGAGCACUUCUGGGUGAAAAUAGUAGCGAAGUAUCGCUCUGCGCCCACCCGUCUUCCGCUCUUCCCUUG
.................................................................................................................................................... .......<..<.<...................................................>.......................<..........>.>><.<<<.....<................>.......>>><..<.......<........>.......>.>...>...................................................... ....................................................
AE015545.1 0.00 .UAUCAGUUCCCAUCUCGCUAGAAUGCCCGCUCGAAUA CCUUUAAGUAGAGGC.GCGCUGCCU.AUGACUA..CUUGUGCGG..........AGGGUGAUGCCGC.AG.....aUGUACAAG.GAAAGG.AGU.CAGCGCCGAAGUAGCCAGGUC....AUCA...AACCGAGC.UGCUGGUUUUG.CAUC...AAAUaGGUG.CAAGACUGCCAUAGUc...AUC...................cACUAUGGAGCGCUACCUGAAGGGGCUGAGGAGUAUUACCUCCCUAUAGGUUUUGUUUCUUUAUCCUCUCGGUAGAUCUCCACCCGUUUUCUUUAGGUGAAAAGAGAUCAUGGAAAUUAGUCAUUUUGCCGACUCCGGUUGGUCAGUGCUUCCCCCUUUGUUAGCCGUCGCCUUGGCGAUCAUCAC
..................................... ..........<..<...........................................................................<.........>.>><.<<<<............................>>>><..<<<<...<..........>...>>>>.>...>...................................................... ...................................................................................................................................................................
AE015829.1 0.00 .GCUACUUUUUUCGUCCCUUUCCGGCGGAA AGGAACAGAAGAGGA.GCGUUAACU.A--GGUA..GUCAAUCAGagga......GCACAAACUCCAG.CG.....aUGAUUGAU.GAGGGA.GAU.UAGCGCCGAGGCAUAGAUGUGgu..UGCU..gCAUGUUUA.UGUCGGUCGCU.UAGGcu.GAAU.CCU-.AACGAUUGUCACCUG....UAA....................UUGGUGGAGAGCUUCUGGUGACGAUUGCUGUUUCCCUUCUUUUGGGGUGCGUAUCAUUGAGCACCAGGCUCUUCGAACGAAGUUAGUUCGGAGCGUAAUCAUGUUAGUUAAUCAAUCUGUUAUUGAAGUUUGUAUCGUAUCUCUUGCUUUUGCGGAGGUGCGCUAAUGUCUCUUGUUGUCGCUAAAUUUGGUG
............................. .......<..<.<..................................................>........................<..........>.>><.<<<<............................>>>><..<<.<....<........>....>.>>.>...>...................................................... .....................................<......................................>..............................................................................................
AE015937.1 0.00 .AGACUAUCUGAAGAGUUAAAUUUAAGCAUAUUUUAAAAAGUUCUUGCUAAAAUGAAAAAUAAAUGAUAUACUUUGUUUUAAACAUAGAUACAAGUGAAUA UAGAAAGGUAGAGGC.GCGGUAUUU.AAUAGUA..UCUGUACA-..........GAUAAAAGCAAGA.UG.....aUGUACAGU.GAAAGG.AAA.UAUCGCCGAAGC-AUGCAGUUaaagCUUU.gaUACUGUAU.GACUGGUCUUA.UUUA...AAAUaUGAA.UAAGAUUGUCACAAAa...UGA...................aUUUGUGGAGAGCUAUCAUUCAAUGGAAAACACCUUUAAAGUGUAGAAACAUCACACUCCUUGAUUGACGAAGCUCAAGGAGUGUUUUUUGUUGGAUGGACUCUUCUCCUCAAAAGAUAUUCA
.................................................................................................... .............<..................................................................................<........>.>...<...........................>.<..<<<<...<..........>...>>>>.>.......................................................... ....................................................................................................
AE016747.1 0.00 .GUCUAUGUAUAAUGAAAACAUAUCAAUUGAAUA AGAUUUUGAUGAGGC.GCAUCAAUC.AUGAGUA..AACUUUAG-auaauu....UGUCUGCUAACAA.UU......AUAGAGUU.AAAAGG.GUG.AGAUGCCGAAAUGAUUCAUAAu...AGCA..gUUAUGAAU.CGUUGGACUUAaUGGU...UAAGaGCUA.UAAGUUUGUCAUUAUu...AUU..................aaAUAAUGGAGUGCAUCACUUGUACAUAAAUGUAGAACAAGUUCGGCAUUCCGAACUUGUUCUUUUUUAUACUGUGUAUGUCUCCUCUAAUUAUAGGAGGACUGAAAUUGAAUAGAAGUGUUUUAAAAUUUGGCGGUUCUUCCGUCAGUGAUUUUAAAAAAAUAAAAAAUAUCGCUGAAAUGCUUAAAACA
................................. ..........<..<..<...........................................>...........................<..........>.>><.<<<<.....<...............>......>>>><..<<<<...<..........>...>>>>.>...>...................................................... ....................<......................................>...........................................................................................................
AE016748.1 0.00 .AUUACAAAUUAAUAUAAUA AAUAGAGUUAGAGGUuGCAUUAUUA.AUGACUA..ACUUAUCAG..........AAGUCGUAUGGGA.CAuguguuGAAUAAGU.GAAAGG.UAA.UAAUGCCGAAAUGAUGUUAUUuc..CAUA..aAUUAGCAU.UGUUGGGACAA.CUUUc..GAAUaGAAG.UUGUACUGUCACU--....UUA....................--UGUGAUGUGCUACCUUAUAUAGAUAAACAUUAGUGGUUGCAUAUCUUAAAGGUAUGUAACCACUUUUUACAUUAUUGAUACAGAUAUAAAGACAAGUGAUAUAAAAGUAAAAUGAUAUUAAUAUUAUUUUACUUUUAUAUCAUCUAUACCAAAUUUAUCUACAACAAUGAUAUGCAUUGAUGUGGUAACAAGUUAGCCUCU
................... ..........<..<.<..................................................>.....................<..........>.>><.<<<..............................>>><..<<<<....<.........>...>>>>.>...>...................................................... ..........................<......................................>...................................................................................................................
AE016770.1 0.00 .GCGCAGCGAAGCAUUUAUUAGCUGAACUACUGACCGCCAGGAGUGGAUGAAAAAUCCGCAUGACCCCAUCGUUGACAACCGCCCCGCUCACCCUUUAUUUAUAAAUGUACUACCUGCGCUAGCG CAGGCCAGAAGAGGC.GCGUUGCCC.A--AGUAacGGUGUUGGA..........GGAGCCAGUCC--.UG....ugAUAACACCuGAGGGG.GUG.CAUCGCCGAGGUGAUUGAACGgcu.GGCC..aCGUUCA-U.CAUCGGCUACA.GGGGc..UAAAuCCCC.UG-GGUUGUCACCAGaagcGUUcgcagucgggcguuucgcaaGUGGUGGAGCACUUCUGGGUGAAAAUAGUAGCGAAGUAUCGCUCUGCGCCCACCCGUCUUCCGCUCUUCCCUUGUGCCAAGGCUGAAAAUGGAUCCCC
............................................................................................................................ .......<..<.<...................................................>.......................<..........>.>><.<<<.....<................>.......>>><..<.......<........>.......>.>...>...................................................... ...................<......................................>.................
AE016801.1 0.00 .CAAAUUUGUUAAUAAAAACUUUCAAUCACGAUCGAAUUAAGCGUUGACAUUGGAGUGUGAAAAACGUUCAAUGUUUAAGCU UUUUGCAGAAGAGGA.GCACUGCCC.A--GGCA..GAUGUUUUGugga......GCCGCAACUCCAA.CA.....cAGAACAUU.CAGGGG.GAG.UAGUGCCGAGGUAGAUCAAAAu...UGCA.ggAUUUGAUC.UGUCGGUUGAC.UUGGguuGAGUcCCA-.-UCAACUGUCAUCAGc...UCA..................gcCUGAUGAAGAGCUUCUGAGAUGGAUUUUCUGAUUAUUCAAACUGACCUCUCUAAACUGCUCUGCCCCUUUCCUCACCAAAACAAACAUCGGAUGUUGGAUUACCAACGGUUAAUAUUUUUCGGAAGUCGUGGGAGAAAUGC
................................................................................. .......<..<.<..................................................>........................<..........>.>><.<<<<....<................>......>>>><..<<<......<......>......>>>.>...>...................................................... ....................................<......................................>...........................................
AE016806.1 0.00 .UGCAAUGAGGAGCGUCAUGAGUACAAUAGCCGCUACCUGAUGCGAUAAAUUAGAUUAUUUGUUGUUUUUUUAAUCGGCAGAUAGUUAAGAAUUUGU UAUCGACGUAGAGGC.GCAAUGGUA.AAGAGUA..ACUAUUAUU..........GGGGUGAUGCCAA.UG.....aAUAAUAGU.GAAAGG.UAUcCAUUGCCGAAGUGAAUUGCAU....AUCA...AAGCAGUU.UGCUGGGGUUG.CAUCc..GAAA.GGAA.CAACACUGCCAUAGUa...UUU............aauguauaACUAUGGAGCGCUACUGUAGGUUGGGUGAAGUGUUCACUUCCCUGUCGCUUAGUUCAACAUAAGUAACGGACAUCCUGUUUACUUUGUCUGCAGUAGAUCUCUAGCCAAACUUUGGUUUUUGAAGA
................................................................................................ ..........<..<...........................................................................<.........>.>><.<<<<............................>>>><..<<<<...<..........>...>>>>.>...>...................................................... ........................................................................................................
AF269374.1 0.00 .AAAAAGAUGAAUUUAUUUGGAAUGUUAUUGAUGAAAUCCGUUUGAAAAAGCAUAGAUAAACUUGAAAAUAUAAAGUAUAUCAUGUAUAUUACAAAUUAAUAUAAUA AAUAGAGUUAGAGGUuGCAUUAUUA.AUGACUA..ACUUAUCAG..........AAGUCGUAUGGGA.CAuguguuGAAUAAGU.GAAAGG.UAA.UAAUGCCGAAAUGAUGUUAUUuc..CAUA..aAUUAGCAU.UGUUGGGACAA.CUUUc..GAAUaGAAG.UUGUACUGUCACU--....UUA....................--UGUGAUGUGCUACCUUAUAUAGAUAAACAUUAGUGGUUGCAUAUCUUAAAGGUAUGUAACCACUUUUUACAUUAUUGAUACAGAUAUAAAGACAAGUGAUAUAAAAGUAAAAUG
.......................................................................................................... ..........<..<.<..................................................>.....................<..........>.>><.<<<..............................>>><..<<<<....<.........>...>>>>.>...>...................................................... ..........................<......................................>............................
AF270308.1 0.00 .GUAUAUUACAAAUUAAUAUAAUA AAUAGAGUUAGAGGUuGCAUUAUUA.AUGACUA..ACUUAUCAG..........AAGUCGUAUGGGA.CAuguguuGAAUAAGU.GAAAGG.UAA.UAAUGCCGAAAUGAUGUUAUUuc..CAUA..aAUUAGCAU.UGUUGGGACAA.CUUUc..GAAUaGAAG.UUGUACUGUCACU--....UUA....................--UGUGAUGUGCUACCUUAUAUAGAUAAACAUUAGUGGUUGCAUAUCUUAAAGGUAUGUAACCACUUUUUACAUUAUUGAUACAGAUAUAAAGACAAGUGAUAUAAAAGUAAAAUGAUAUUAAUAUUAUUUUACUUUUAUAUCAUCUAUACCAAAUUUAUCUACAACAAUGAUAUGCAUUGAUGUGGUAACAAGUUAGC
....................... ..........<..<.<..................................................>.....................<..........>.>><.<<<..............................>>><..<<<<....<.........>...>>>>.>...>...................................................... ..........................<......................................>...............................................................................................................
AF306669.1 0.00 .UAACUUGAAUUUUCAGGUUAUUCCAAAAAAUCUAAAUUAUCGGUUUACAUUCAUAUUUGUCAUAUGUAUAAUGAACACAUACCAAUUUAAUA AUAUUUUGAUGAGGC.GCAUCAAUC.AUGAGUA..AAGUUUAGA..........UUACUGUCUGCUA.AC....agCUAAAUUU.GAAAGG.GUG.CGAUGCCGAAGCAAUUAUAAU....AGCA...GUUAUAAUuUGUUGGACUUU.UUGGu..UAAGaGCUG.AGAGUUUGUCAUUAUu...UAA..................aaAUAAUGGAGUGCAUCACUUGUAUAUAGAUUAAGAGCAAGUUCGCAUUCCGAACUUGUUCUUUUUUUAUUAUUGUGUGCCCUUCCUAACAAUUAGGAGGAUUAUAUGGUAACAAGAAGUGUGUUGAAAUUU
............................................................................................ ..........<..<..<...............................................>.......................<..........>.>><.<<<<....<.................>.....>>>><..<<<<....<.........>...>>>>.>...>...................................................... ....................<.....................................>.................................................
AP001513.1 0.00 .ACUAUUUACAUAAACUUAAGCGAAAAUAUUGAUUUCACAUUGCAUUCUUAAUCAUCUUCUGUUAAGGUGGAGACACAAUCACAUAUAUCUCAACUUCUUAUUAUUGA AGUGAGGAUAGAGGU.GCAAAAACC.AAGAGUA..CACAAUUGG..........AGGAGAAUGAGAU.CC.guugaGAAUUGUG.GAAAGG.GGA.AUUUGCCGAAGCUGGAAGAAU....CUCA..uGUUCUGAA.GGCUGGUUCUG.UAUU...AAAUaAAUA.CAGAACUGUCAUAUAgcg.GAU...............guugcUAUAUGGAGGGCUAUCUCACGCAUCGGAAUGGUUGUUAAUCAACACAUACCAUGCAACAAUGAGCCCUCUCAUUGUUGCUUUUUUGAUGUCGUAUAGCUUUUUCUUUGCGAUGAG
........................................................................................................... ..........<..<..<...................................................>....................<.........>.>><.<<<<.<...................>......>>>><..<<<<...<..........>...>>>>.>...>...................................................... ........................<..................................>.................................
AP001517.1 0.00 .CUGAUAAGAUAUUAACCAAUUGAAUAACCGCGCUUCAAUUUGA AGUGAUGGUAGAGGU.GCGAAAACC.AAGAGUA..CACAGUCUG..........AGAGAAAUGAGAA.UC.guugaCGACUGUUgGAAAGG.GGG.AUUCGCCGAAGUGCAGAUCGGgg..CUCA.uuCCCAUUUG.CGCUGGACCUA.UGUU...GAAUaAGCA.UAGGGCUGUCACAACa...CUA........gccccaacuaguGCUGUGGAGAACUAUCUCACGUAGCUACGGGAAUGCGCACGUUUUUAUUUUCGUGUACAGUACGCAAUGGUGAGGAGUUUUCCUGCUGUUGCGUUUUUGUUUUCUUUAUGCGCGAUUUCCAAGCGAAGAACAGAAAGGGGAAACCUAUGUCAAUCAUUGUACAGAAGUAUGGAGGCACG
........................................... ..........<..<..<...................................................>....................<.........>.>><.<..........<................>......><..<<<<...<..........>...>>>>.>...>...................................................... ..............................<......................................>.......................................................................................
AP001518.1 0.00 .UGCGACAUGAAAUAUAUUAUGGUAGAAUAACUCACGAUUAAUUGAAUAGAUGGUGUGCCUCAUCCACA AGAUGGGGUAGAGGA.GCGGGUUUU.AAGAGUA..AGCGCUUGG..........AGGAUGACAACGA.GG.....aUAAGCGCC.GAAAGG.AAA.ACUCGCCGAAGCG-GAAGAUGa...GUCA.agCGUCUUCU.UGCUGGGGUUG.CAUU...GAAUaAAUG.UAACACUGUCACAGCa...GAU...................uGCUGUGGAGAACUACUAACGUUGUGAUGGGGUUUCCUUGUGCGGAUAAAAGGGCAAUGGGAGAGAUCGAUCUCAUCAUUGCUCUUUUUUUGUGCCCUAAGUAAUAGAUAUAGAAGAAGGGAUUCGCUGAAAAGCGUGAUUCCAUUACGACGAAG
.................................................................... ..........<..<...........................................................................<.........>.>><.<<<<..<..................>......>>>><..<<<<...<..........>...>>>>.>...>...................................................... ......................<......................................>......................................................................
AP002568.1 0.00 .CCUGCGCUAGCG CAGGCCAGAAGAGGC.GCGUUGCCC.A--AGUAacGGUGUUGGA..........GGAGCCAGUCC--.UG....ugAUAACACCuGAGGGG.GUG.CAUCGCCGAGGUGAUUGAACGgcu.GGCC..aCGUUCA-U.CAUCGGCUACA.GGGGcu.GAAU.CCCC.UG-GGUUGUCACCAGaagcGUUcgcagucgggcguuucgcaaGUGGUGGAGCACUUCUGGGUGAAAAUAGUAGCGAAGUAUCGCUCUGCGCCCACC
............ .......<..<.<...................................................>.......................<..........>.>><.<<<.....<................>.......>>><..<.......<........>.......>.>...>...................................................... ................................
AP003133.2 0.00 .AAAAAUCUAAAUUAUCGGUUUACAUUCAUAUUUGUCAUAUGUAUAAUGAACACAUACCAAUUUAAUA AUAUUUUGAUGAGGC.GCAUCAAUC.AUGAGUA..AAGUUUAGA..........UUACUGUCUGCUA.AC....agCUGAAUUU.GAAAGG.GUG.CGAUGCCGAAGCGAUUAUAAU....AGCA...GUUAUAAUuUGUUGGACUUU.UUGGu..UAAGaGCUG.AGAGUUUGUCAUUAUu...UAA..................aaAUAAUGGAGUGCAUCACUUGUAUAUAGAUUAAGAGCAAGUUCGCAUUCCGAACUUGUUCUUUUUUUAUUAUUGUGUGCCCUUCCUAACAAUUAGGAGGAUUAUAUGGUAACAAGAAGUGUGUUGAAAUUUGGCGGAUCAUCCGUCAGUGAUUUUA
................................................................... ..........<..<..<...............................................>.......................<..........>.>><.<<<<....<.................>.....>>>><..<<<<....<.........>...>>>>.>...>...................................................... ....................<.....................................>..........................................................................
AP003134.2 0.00 .UAGUUAAAAUAUUA AAUUGAGUUAGAGGUuGCAUGUUUA.AUUAGUA..ACUUGUCAGaaguauuu..AUGGUACAUAAGU.UG......-AACAAGU.GAAAGG.UAA.AGAUGCCGAAAUAGAUAUAAAc...CAUA..aAUUAUAUC.UAUUGGGACAG.UUUUc..GAAUaGGAA.CUGUACUGUCACA--....GAA....................--UGUGAUGUGCUACCUUAUAUAGAUAAUUGCCAAAGUGGUUGCAUAUCUUAAAGGUAUGUAGCCACUUUUUUACUUUUAAUAUCACUAUGUUCUGUAAAAAAGGGUAUGAAAGUGAAUAAAGGUUAUUUAUUUCUUGGCCUCUAAAACAUGGAAAGGGAGCUUAUAUGUCAAAAGUUCAAAAUGAAAGUAACAAUGUUGUCAAAAGG
.............. ..........<..<.<...........................................>............................<..........>.>><.<<<<.....<...............>......>>>><..<<<<....<.........>...>>>>.>...>...................................................... ............................<.....................................>.......................................................................................................................
AP003187.2 0.00 .ACAUUAUAAACAAUAAUUAAUAUAAUAAAAGCAUAAAUAAUUUGAAAAUAG GACCAAAGUAGAGGU.GCCGUAAUU.AAGAGUA..GUCAUAAG-..........UAGCUGACAAG--.UG.uuuuaUGUAUGAU.GAAAGG.GAU.UAUGGCCGAAGAGAUAUUAAU....GGUG...AUUAAUAU.UUCUGGGUAUA.UGUA...UAAUaUGCA.UAUAACUGUCACUUUg...AAA....................AAAGUGGAGUGCUACAAGGUACGCUAAGUUGCGAUUAAGGCAGCAAAGGUGUUCCUUUGCUGUUUUUAUUUAUUGGAAUUAAAUGCCAGGAGAGUCGGUAGCUUUGCAUACUUUUAUACUCUGCCACUAAAAAAGUUUGUGGAGGGAAAAGAUAUGAAAUUAUUUGGAUCA
................................................... ..........<..<.......................................................................................>><..<.<....<.................>......>.>........<..........>...........>......................................................... .....................................................................................................................................................
AP003189.2 0.00 .GAUUUAAAGUCAACAAUAAAACCUAAACUAUUUUAUAAAUUAUUAAGUAAUUUUUGUUUGUAAUUUUUAUUUAUCAAUAAAAAAAUAUUGACAUUUUACAAAUUUAAUCUCAUAAUUGUUAAUAUAAAGUGAAU AACUGAGAUAGAGGC.GCGAUGAUU.AAUAGUA..UCUUUGCA-..........GAGGUAAGCACAU.UG.....aAGCAAAGU.GAAAGG.AUG.AAUCGCCGAAACCAUUAGAAGa...GGCUuuaAUUCUAUUaGGUUGGGGUUG.CAUA...GAAUaUAUG.UAACACUGUCACAAAu...UAU....................UUUGUGGUGUGCUAUCAUGAAAGAAGAGUAUUGUAUAUAACUUUACGAACCCUUAAGCAUGAAACACGCUUAAGGGUUUCUUUUGUUA
...................................................................................................................................... ..........<..<.............................................................................................>><.<....<..............>......>.><..<<<<...<..........>...>>>>.>.......................................................... ......................<.....................................>.....
AP003194.2 0.00 .AAUAAAGUAAUUAAAUACUUGAAAGAAACAUAGUUAUAUUGUAUAAAUGUAUACAAUAUAAUAAUUAAAAGUGAAUAAUUUA AAAAGAGGUAGAGGC.GCGAGAAUC.AAGAUUA..CUAAAAUGG..........AGUUAAGUAGCGU.AG.....aAGUUUUAG.GAAAGG.GAU.UAUCGCCGAAGUUUUUGGCUAaua.CUUU..aAGGCUAAA.UGCUGGGGUUG.UAUA...GAAUaUAUA.CAACACUGUCACA--....AAA....................--UGUGGAGAGCUAUCAUCUUAGGGAAUUAAAUAAAUAAAAGUUUAUUUGCAAAAGUAAUUUUAUUAAGUAUUAAGACCUUAGGUUGAUCAAGCCUAAGGUCUUUUUUGCAGAAAUUUUAUAAUAAGAAAAAAUAAGGGA
.................................................................................. ..........<..<..................................................................................<........>.>>..<<........................>>..<..<<<<...<..........>...>>>>.>.......................................................... .....................<..............................>.................................................................
AP003362.2 0.00 .UCAUAUGUAUAAUGAACACAUACCAAUUUAAUA AUAUUUUGAUGAGGC.GCAUCAAUC.AUGAGUA..AAGUUUAGA..........UUACUGUCUGCUA.AC....agCUGAAUUU.GAAAGG.GUG.CGAUGCCGAAGCGAUUAUAAU....AGCA...GUUAUAAUuUGUUGGACUUU.UUGGu..UAAGaGCUG.AGAGUUUGUCAUUAUu...UAA..................aaAUAAUGGAGUGCAUCACUUGUAUAUAGAUUAAGAGCAAGUUCGCAUUCCGAACUUGUUCUUUUUUUAUUAUUGUGUGCCCUUCCUAACAAUUAGGAGGAUUAUAUGGUAACAAGAAGUGUGUUGAAAUUUGGCGGAUCAUCCGUCAGUGAUUUUACAAAAAUAAAAAGGAUCGCUGAAAUGUUAAAGGA
................................. ..........<..<..<...............................................>.......................<..........>.>><.<<<<....<.................>.....>>>><..<<<<....<.........>...>>>>.>...>...................................................... ....................<.....................................>............................................................................................................
AP003363.2 0.00 .UUUAUCUGGAAUCUAGUUGAUGAAAUUCGUUUGAAAAAACAUAGAUAGACAGUUGUCGCAAUAAAAUGCUUUAAAACUUUUAUUGCGUAUCAAGUUUUACAGGGUUGAUUAUGCGUGAUGAAUCCUGUAUAUUACAAGUUAGUUAAAAUAUUA AAUUGAGUUAGAGGUuGCAUGUUUA.AUUAGUA..ACUUGUCAGaaguauuu..AUGGUACAUAAGU.UG......-AACAAGU.GAAAGG.UAA.AGAUGCCGAAAUAGAUAUAAAc...CAUA..aAUUAUAUC.UAUUGGGACAG.UUUUc..GAAUaGGAA.CUGUACUGUCACA--....GAA....................--UGUGAUGUGCUACCUUAUAUAGAUAAUUGCCAAAGUGGUUGCAUAUCUUAAAGGUAUGUAGCCACUU
......................................................................................................................................................... ..........<..<.<...........................................>............................<..........>.>><.<<<<.....<...............>......>>>><..<<<<....<.........>...>>>>.>...>...................................................... ...............................................
AP004598.1 0.00 .AAUCAUAUUCAUAG GUUUUGGAUAGAGGU.GCGGAGACC.AUCAGUA..UAUACGCGGaagg......GAAAUGAGCCCUAgUG.....aAGCGUAUG.GAAAGG.GGA.AUCUGCCGAAGCGAGUGAAAUa...CUCA.uuCAUUAACU.CGUUGGUGCUGcUAUU...GAACaAAUAaCAGUGCUGUCAUAUAgg..AGA...................cUAUAUGGAGGGCUAUCGAGCUGGGAACUUAUAUGUUCAGCAGCAACGGGCUUCCGUUGGUGCUUUUUAAUUUGGCCCAACCCUCUUAAAGCAAGUUUGUUCAAAUUAUAAAAAGGGUGUGUUUACAUGAAUUUUGGAAAAGUAUUAACAGCGAUGGUGACGCCUUUCGAUAAACAUGAAGAAAUCGAUUUUCAAGCAUUGGAUCAUUU
.............. ..........<..<..<.............................................>.........................<..........>.>><.<<<<............................>>>><..<<<<..................>>>>.>...>...................................................... ........................................<......................................>..........................................................................................................
AP004601.1 0.00 .UUAUCAGAU CGGUGAGGUAGAGGA.GCAUACAAC.AUUAGUA..AUCGACAAG..........AGGAUGACAACGA.UG.....aUAGUUGGU.GGAAGG.GUU.GUUUGCCGAAGCA-UAAUAAGg...GUCA.gaCUUAUUAU.UGCUGGUACAU.CUUU...GAAUaAAAG.AUGCACUGUCAUGCAa...AAU................uaagUGCAUGGAGAACUACUGAUCGAAAUGGAGGAUAACGUUAGUUGGUAAAACAAUGAUGGUUAUUUUCUGUCGUUGUUUUUUUUGUGCUUAAAAAUAGCAACGUUGCUUUACAUCAAGAGCAUUUCGGGUAUUAUCUCCAUCACCAAAUAAUUAUUUGGAGGUAACAACUAUGGAAGGUACAAUUUAUUCACUUAUUCCUGCAGUAAUUAUGCUA
......... ..........<..<..<...............................................>.......................<..........>.>><.<<<..............................>>>..<..................>.........>......................................................... .......................<.....................................>.................................................................................................................................
AP004826.1 0.00 .CUAUAAGUAUUUUGAAUUUUAUUUUUCAAAAAGUCUCAUUAUCACCACCUUUUAAAAUAUAAGCAACGCUAUAACUUGAAUUUUCAGGUUAUUCCAAAAAAUCUAAAUUAUCGGUUUACAUUCAUAUUUGUCAUAUGUAUAAUGAACACAUACCAAUUUAAUA AUAUUUUGAUGAGGC.GCAUCAAUC.AUGAGUA..AAGUUUAGA..........UUACUGUCUGCUA.AC....agCUAAAUUU.GAAAGG.GUG.CGAUGCCGAAGCGAUUAUAAU....AGCA...GUUAUAAUuUGUUGGACUUU.UUGGu..UAAGaGCUG.AGAGUUUGUCAUUAUu...UAA..................aaAUAAUGGAGUGCAUCACUUGUAUAUAGAUUAAGAGCAAGUUCGCAUUCCGAACUUGUUC
................................................................................................................................................................... ..........<..<..<...............................................>.......................<..........>.>><.<<<<....<.................>.....>>>><..<<<<....<.........>...>>>>.>...>...................................................... .....................................
AP004827.1 0.00 .UGGAUCGCAAGACCAAGAAACAGUUGAAAAAGAUGAAUUUAUCUGGAAUCUAGUUGAUGAAAUUCGUUUAAAAAAACAUAGAUAGACAGUUGUCGCAAUAAAAUGCUUUGAAAUUUUUAUUGCGUAUCAAGUUUCACAGGGUUGAUUAUGCGUGAUGAAUCCUGUAUAUUACAAGUUAGUUAAAAUAUUA AAUUGAGUUAGAGGUuGCAUGUUUA.AUUAGUA..ACUUGUCAGaaguauuu..AUGGUACAUAAGU.UG......-AACAAGU.GAAAGG.UAA.AGAUGCCGAAAUAGAUAUAAAc...CAUA..aAUUAUAUC.UAUUGGGACAG.UUUUc..GAAUaGGAA.CUGUACUGUCACA--....GAA....................--UGUGAUGUGCUACCUUAUAUAGAUAAUUGC
.............................................................................................................................................................................................. ..........<..<.<...........................................>............................<..........>.>><.<<<<.....<...............>......>>>><..<<<<....<.........>...>>>>.>...>...................................................... ..........
J03294.1 0.00 .UGCUGUUAAAGCAUUUCGGUUCCGUUAAAAAAAUGAAGGAAGCAAGCCUUGAGGACAUCAAAAAAGCCGGUGUUCCGCAGCGGCGGCUCAGCUCCUUUACGACAAAUUGCAAAAAUAAUGUUGUCCUUUUAAAUAAGAUCUGAUAAAAUGUGAACUAAUUUCAUAGUUAGAUCGUGUUAUAU GGUGAAGAUAGAGGU.GCGAA-CUUcAAGAGUA..UGCCUUUGGaga.......AAGAUGGAUUCUG.UG.....aAAAAGGCU.GAAAGGgGAG.CGUCGCCGAAGCAAAUAAAAC....CCCAucgGUAUUAUU.UGCUGGCCGUG.CAUU...GAAUaAAUG.UAAGGCUGUCAAGAAa...UCA..................uuUUCUUGGAGGGCUAUCUCGUUGUUCAUAAUCAUUUAUGAU
...............................................................................<.....<......................................>.............................><.<<<<.......<............> .....>>>><..<<<.<.....<.......>....>>>>.>...>......................................................................................................................................................................................... ..................
M93419.1 0.00 .UAAAAAAAAUGAAGGAAGCAACAAUGGCGGAAAUUACAUCUGUCGGCAUUCCGGCAAAUGUUGCAAAAGAAUUGAUGAAAAAGUUGCAUGAAUGACAUUGUCAUAAAUCAGGUCGUAUGCUAUACUGAAAAAAAUUUUAUAGUGUAAUCACUUUAGAGCAUUAA AGUGAAGAUAGAGGU.GCGAACUUC.AUCAGUA..AAAGCUUGGagaa......GAAUGAGCUUCAA.UG.....aAAAGCUUU.GAAAGG.GAAcGUUCGCCGAAGUGAAGAAAAA....CUCA.uuUUUUUCUU.UGCUGGUCCUG.CAUU...UAAGaGAUG.CCGGAUUGUCAAGGCgg..UGC...................cGCCUUGGAGAGCUAUCUCACUGUGUCUGCGUAUUUUACUACGUUAUCCACAGCAAUGA
..............................................................<......................................>...............................<<<<.......<..................> .....>>>><....<......<........>.....>...>............................................................................................................................................................................................. ....................................
U00006.1 0.00 .UGCCGUUAGCGUAAUGUUGAGUGUAAACCCUUAGCGCAGUGAAGCAUUUAUUAGCUGAACUACUGACCGCCAGGAGUGGAUGAAAAAUCCGCAUGACCCCAUCGUUGACAACCGCCCCGCUCACCCUUUAUUUAUAAAUGUACUACCUGCGCUAGCG CAGGCCAGAAGAGGC.GCGUUGCCC.A--AGUAacGGUGUUGGA..........GGAGCCAGUCC--.UG....ugAUAACACCuGAGGGG.GUG.CAUCGCCGAGGUGAUUGAACGgcu.GGCC..aCGUUCA-U.CAUCGGCUACA.GGGGcu.GAAU.CCCC.UG-GGUUGUCACCAGaagcGUUcgcagucgggcguuucgcaaGUGGUGGAGCACUUCUGGGUGAAAAUAGUAGCGAAGUAUCGCUCUGCGCCCACCCGUCUUCCGCU
............................................................................................................................................................. .......<..<.<...................................................>.......................<..........>.>><.<<<.....<................>.......>>><..<.......<........>.......>.>...>...................................................... ...........................................
U32832.1 0.00 .GUUUAUUUUCUUUAUAUUUUUAUUAAAGUUUAUAAAAUUUUUAUAAAAUCUGUUGGCAUUUUGUUUGUUUUACGGUAAUCUCCCCAAUCAC UACAAAAGUAGAGGC.GCAAUUAUU.AUAAGUA..UUUUUUCA-..........GAGUGGAUAACGA.AG.....aAGAAAAAA.GAAAGG.AAU.AGUUGCCGAAAUCAAAUAAAA....GUCG...UUUUGUUU.GGUUGGUGGCG.UGCUc..GAAA.GGGG.CGACACUGUCAUAGUu...UUU.............cugauuaACUAUGGAGUGCUACGGUUGUUCUGGUCUUAUUCUGUCCUAUGCUUUCCGUUCUCUCCAUUAAUUAUAGGUAUUAUUUAAUGGAACUUAUUGAUUUUUCAUCAUCUGUUUGGUCAAUCGUCCCUGCUUUGU
........................................................................................... ..........<..<...........................................................................<.........>.>><.<<<<............................>>>><..<.<<...<..........>...>>.>.>...>...................................................... .......<...................................>.................................................................
X00008.1 0.00 .UCGUUGACAACCGCCCCGCUCACCCUUUAUUUAUAAAUGUACUACCUGCGCUAGCG CAGGCCAGAAGAGGC.GCGUUGCCC.A--AGUAacGGUGUUGGA..........GGAGCCAGUCC--.UG....ugAUAACACCuGAGGGG.GUG.CAUCGCCGAGGUGAUUGAACGgcu.GGCC..aCGUUCA-U.CAUCGGCUAAG.GGGGcu.GAAU.CCC-.CUGGGUUGUCACCAGaagcGUUcgcagucgggcguuucgcaaGUGGUGGAGCACUUCUGGGUGAAAAUAGUAGCGAAGUAUCGCUCUGCGCCCACCCGUCUUCCGCUCUUCCCUUGUGCCAAGGCUGAAAAUGGAUCCCCUGACACGAGGUAGAUUAUGUCUGAAAUUGUUGUCUCCAAAUUUGGCGGUACCAGCGCUAGCGAUUUUG
........................................................ .......<..<.<...................................................>.......................<..........>.>><.<<<.....<................>.......>>><..<.<<....<........>....>>.>.>...>...................................................... ...................<......................................>.....................................................................................
X15196.1 0.00 .CCCAUCGUUGACAACCGCCCCGCUCACCCUUUAUUUAUAAAUGUACUACCUGCGCUAC GCAGCCAGAAGAGGC.GCGUU-GCC.A--AGUAacGGUGUUGGA..........GGAGCCAGUCC--.UG....ugAUAACACCuGAGGGG.GUG.CAUCGCCGAGGUGAUUGAACGgcu.GGCC..aCGUUCA-U.CAUCGGCUACA.GGGGcu.GAAU.CCCC.UG-GGUUGUCACCAGaagcGUUcgcagucgggcguuucgcaaGUGGUGGAGCACUUCUGGGUGAAAAUAGUAGCGAAGUAUCGCUCUGCGCCCACCCGUCUUCCGCUCUUCCCUUGUGCCAAGGCUGAAAAUGGAUCC
.......................................................... .......<..<.<...................................................>.......................<..........>.>><.<<<.....<................>.......>>><..<.......<........>.......>.>...>...................................................... ...................<......................................>...............
Z75208.1 0.00 .CCGUUAAAAAAAUGAAGGAAGCAAGCCUUGAGGACAUCAAAAAAGCCGGUGUUCCGCAGCGGCGGCUCAGCUCCUUUACGACAAAUUGCAAAAAUAAUGUUGUCCUUUUAAAUAAGAUCUGAUAAAAUGUGAACUAAUUUCAUAGUUAGAUCGUGUUAUAU GGUGAAGAUAGAGGU.GCGAA-CUUcAAGAGUA..UGCCUUUGGaga.......AAGAUGGAUUCUG.UG.....aAAAAGGCU.GAAAGGgGAG.CGUCGCCGAAGCAAAUAAAAC....CCCAucgGUAUUAUU.UGCUGGCCGUG.CAUU...GAAUaAAUG.UAAGGCUGUCAAGAAa...UCA..................uuUUCUUGGAGGGCUAUCUCGUUGUUCAUAAUCAUUUAUGAUGAUUAAUUGAUAAGCAAUGAG
..........................................................<.....<......................................>.............................><.<<<<.......<............> .....>>>><..<<<.<.....<.......>....>>>>.>...>......................................................................................................................................................................................... .......................................
Z99118.2 0.00 .AAGAAAAUGCUGUUAAAGCAUUUCGGUUCCGUUAAAAAAAUGAAGGAAGCAAGCCUUGAGGACAUCAAAAAAGCCGGUGUUCCGCAGCGGCGGCUCAGCUCCUUUACGACAAAUUGCAAAAAUAAUGUUGUCCUUUUAAAUAAGAUCUGAUAAAAUGUGAACUAAUUUCAUAGUUAGAUCGUGUUAUAU GGUGAAGAUAGAGGU.GCGAA-CUUcAAGAGUA..UGCCUUUGGaga.......AAGAUGGAUUCUG.UG.....aAAAAGGCU.GAAAGGgGAG.CGUCGCCGAAGCAAAUAAAAC....CCCAucgGUAUUAUU.UGCUGGCCGUG.CAUU...GAAUaAAUG.UAAGGCUGUCAAGAAa...UCA..................uuUUCUUGGAGGGCUAUCUCGUUGUUCAUAAUCAU
......................................................................................<.....<......................................>.............................><.<<<<.......<............> .....>>>><..<<<.<.....<.......>....>>>>.>...>......................................................................................................................................................................................... ...........