Seq ID Score (bits) Sequence
AB022308.1 0.00 .AAUUAGUUG GAACGCCGUAUGCU.G.-..GAAACUCGCCUGUACGGUGUGAA......................GU.GGGGGaaaagcug............................................................GAGAUAACUUCAAAAGCUUA..CCUA.UC.AC..UAU..AACAACACUUUUAAAGAAAAUUGGAUAUCUAUGUUAAAUUUCAGAAUAGAUGGUAAGGUUAUACUUAACUAAUGGGAUAGUUUAGUUUUAGAAGAUAAAAUAAUAAAUCAUACUUGACCUGUACUAUGGUACAGGGUUUAUUCUGUACUAGGAAGAAAAAUUCCUGUAAAUAAUUGCAGAUCAAAUAGAGG
......... .................................................................................................................................................................................... ...............................................................................................................................................................................................
AB027572.1 0.00 .CUUGAAUGAAAUUAGGGAACGAAGUAAGUAGAUUAGAUGGAUUUAGAUAGAAUUUCUAUCUCCUACUCUAUAAGGAUCAUCUAGAAAGCAGAGAGCUUUGGUUCCAUUCAAAUAGAAAAGCUGACAUAGAUGUUAAGUGGUGAGAAUAUCCAUAA AGGAGCCGAAUGAA.A.U..CAAAAUUUCAUGUUCGGUUUUGAa.....................UU.AGAGAcg..................................................................UUAAAAAUAAUCAACCAACG..UCGA.CU.AU..AAC..CCCUAGCCUUCCAAGCUAACGAUGCGGGUUCGAUUCCCGCUACCC
........................................................................................................................................................... .................................................................................................................................................................................... .............................................
AB042240.3 0.00 .GAGUCAAAUAGCAAUGAUUCGAAGCACUUCUUUUUCCAUUACACUAUUUCGGAAACCUAAGGACUCGAUCGUAUGGAUAUGGAAAAUACAGGAUUUCCGAUCCUAGCGGGAAAAGGAGGGAAACGGAUACUCAAUUUAAAGUGAGUAAACAGAAUUCCAUACUCGAUCUCAUAGAUCCCUAUAGAAUUCUGUG GAAAGCCGUAUUCG.A.U..GAAAGUCGUAUGUACGGCUUGG-......................AG.GGAGA....................................................................-UCUUUCCUAUCUUUCGAGA..UCCA.CC.CU..-AC..AAUAUGG
................................................................................................................................................................................................. .................................................................................................................................................................................... .......
AE007285.1 0.00 .AAGACACGCGCCAGCCUCUUCUUGCGAAAGCUGGCGCGGGAAAAUCCGGGGCUGUUCGUGCAUUGGAAGGCGUUCGGAACGAACACGUUUACCUGAU GGGAGCGGUGUGAA.U.C..GAGAGGUUCACGCACCGUUCUG-......................CG.AGAGGcc..................................................................GGCUGGUGAAACUCCUCCGG..CCUA.CU.CA..-CC..CCUGGACGAAGACGAACAUGGCGCCGCUGCGGGGCUGGGCGCCUCGCGGCGAACGACUGGUGGGCUACGCCCCCUUCGGCCAUUGGAACACCAUGACCUUUGU
................................................................................................. .................................................................................................................................................................................... .......................................................................................................
AF029891.1 0.00 .AUAGUUUCAAGUAAAAAAGAUAUUGAAAGUCUUAUUGAACUUUUAGAUAGCAAGCGUGUUGUUCCAUUAGCAGGUCAUAAAUUAAUGCAGUAUAAUGAAUGAAAGCAUACCUGAUUUAAUAAAUAAUAAGUAUAAAAUAGUUAGACGCAGUUAAUGU UUGAGCCGUAUGCC.A.U..GAAAGUGGCACGUACGGUUCUGA......................GG.GGGGG....................................................................--AAAGUCUGAGAGGACCUA..CCUA.UC.CC..--A..ACUAGGGACCCUAGUAGUCUUUGCAGAAAAUGAUGAGUGCCAU
............................................................................................................................................................. .................................................................................................................................................................................... ...........................................
AF065404.1 0.00 .ACAGCAAAAAAGCAGUUAGAACAAUGUUAAAUACAUUUAAAAAGUUUAAAUACUAGAUUGUUAAGGAUAAAGAGAGGC UUGAGCCGUAUGUG.C.U..GAAAGGUACAAGUACGGUUCUU-......................AG.GGGAGaa..................................................................AGAGUUGGUAACACCUCUGA..CUUA.CC.CG..ACU..ACUUGCAACACCUACAUUGAUAUUUUAUCAAUUACCAUAUAGCUUAUUCGCGUUGAAUCAGGCAGCAAGAAGACACUGUCGUAUUGGCCAAACUAAGCAAUGUAGGACCUUCUAUCUUGGAU
.............................................................................. .................................................................................................................................................................................... ..........................................................................................................................
AF074613.1 0.00 .ACUUGUUCAUGCGAAAGGUAUACAUGUAGUGAAACCGGCUCAUGAGAGUGGGCUUAGAAAGGC UUGAGCCGUAUGCC.G.G..GAAACUGGCACGUACGGUUCUU-......................AG.GGGGC....................................................................GGUGAUGCAGUAAUGCAUCAcuGCUA.CC.CGauCGU..AUGUAUUUUUCUGGUGAACCGGCACAGAUCGCUGAGAUUAAACGACUGGCCAGCGGUGCAGUCACACCGCUUUAUCGCCGCGCCACAAAUGAAGGUAUUCAGCUGUUUCUGGCCGGAAGUGCCGGACUUCUGCAGAC
............................................................... .................................................................................................................................................................................... .........................................................................................................................................
AF080083.1 0.00 .AAGACCACCUGAGCGAACCGACCGAAGGGACUUGACUUAUUCGAACCGAACGAUAGCGGCUUAAAGCUAAGCCUAUCACAAGCAGCGACGCUGCUUGAUCGGCGGGGAGGAGCAUCUCAAAGUAUGGGGCAAAGGAUCAAGCGCUUUGACUUUGUCCCCCGGGAUCCACCACAGGUUGGGUUU GAGAGCCGUGUGAU.G.G..GUGACUAUCCAGCACGGUUCGG-......................AG.AGCACuuuuagucugcguuggugaaugaaagcccccccccaucaagcaagaaagaagcggcuc..........UUCCCACGGCGGAGUCACCA..UUGA.CU.CU..-AU..UUAUUAUUAUGGUAAAU
....................................................................................................................................................................................... .................................................................................................................................................................................... .................
AF087656.1 0.00 .AACUUUAAUCAAGGAAAUUAAAGCUAAAAUGAAUUCUAAAAGAGAUUAAUUGAAUAAUUGACCUUAAAUUUAGGGAUUAAACUAAUAUUGAAACUUAUGC UUGAGCUGUAUGCG.A.U..GAAAGUCGCACGUACAGUUCUUA......................GA.GGAUG....................................................................-UUAAUAUAGUAAUAUUUAA..CGUAgCC.UC..AACagACCCUAUGCAGCUUUACUGUAGUUAGUUAUCAUAUGAAUCUAGAACAAUCUUGUUUAAUAGUGAAUAGGAAUGUCGAUAGACUAAAUAGUGGAACCUUAU
.................................................................................................... .................................................................................................................................................................................... ....................................................................................................
AF143421.1 0.00 .UUGAGGGGCGGAGCCGCUCGACCGAUAGGCCGCCAUCGGAAUAAAUUAUAGUCAAAACCCUAUAGAAGGGGAAGGGGGGAUCCUGUUCGGACAUACGGUGGUUGUUACCCUUAAGAACCAUAAUAUCAAGUUG GUGAGCCGUGUGAU.G.G..GAAACCUCCCCGCACGGUUCGG-......................AG.AGCACuuaauuagaauguuccuggggguaccacaucauugcaaggguaaaagagcucgauucgcagauug...GUUCGACCCGGAAUUCACUU..CCGA.CC.CU..-GU..GUUUGAUAGCCCGACCGUAGUUAUGCCAAUUGUGGUUACAUUCGUAAGUAGCUUGGUCCAUCCCCAU
..................................................................................................................................... .................................................................................................................................................................................... ...................................................................
AF143423.1 0.00 .GUAAUAACGCGCGCGCGAGGGGAAGGUCCUGAAAGGUCAACCCAGUAAGGUCCUGUCCUGAUAAACCCUUAUAACUCCUUUUAGGGGAAUAAAUUAUAGUAAAAACCCUAUAGAAGGGGGGGGAAGGGGGGAUCCUGUUCGGACAUACGGUGGUUGUUACCCUUAAGAACCAUAAUAUCAAGUUG GUGAGCCGUGUGAU.G.G..GAAACCUCCCCGCACGGUUCGGAgagcacuuaauuagaauguuccUG.GGGGGuaccacaucauugcaaggguaacagagcucgauucgcagauug.........................GUUCGACCCGGAAUUCACUU..CCGA.CC.CU..-GU..GUUUGAUAGCCCGAC
......................................................................................................................................................................................... .................................................................................................................................................................................... ...............
AF143424.1 0.00 .AGGGGAAGAAAUUAGAGUCAAAACCCUAUCAAAGGGGAAGGGGGUAUCCUGUUCGGACAUACGGUGGUUGUUACCCUUAAGAACCAUAAUAUCAAGUUG GUGAGCCGUGUGAU.G.G..GAAACCUCCCCGCACGGUUCGG-......................AG.AGCACuucauucuaauguuccuggggguaccacaucauugcaaggguaacagagcucgauucgcagauug...GUUCGACCCGGAAUUCACUU..CCGA.CC.CU..-GU..GUUUGAUAGCCCGACCGUAGUUAUGCCAAUUGUGGUUACAUUCGUAAGUAGCUUGGUCCAUCCCCAUCCCAUUUCAUAUAUGUCCGAGGAUCCACAUAGCC
................................................................................................... .................................................................................................................................................................................... .....................................................................................................
AF143425.1 0.00 .UGGAUCAGCGGCGUAAGGGAAGAAGGGGCCUAAGUCGGUCGGCAGAUGCCGUACACUUGAGUGGCAAAGGAAAGCGAUACCGUACCCUCGAAUGAGACAAUUACUUAUUCAUUCAAGGGGGAUCCUGUUCGGACAUACGGUGGUUGUUACCCUGAAUAACCAUAAUAUCAAGUUG GUGAGCCGUGUGAU.G.G..GAAACCUCCCCGCACGGUUCGGAgagcacuucauucgaau.....GG.GGUGAaccaccacaucauugcaaggguaacagagcucgcucgauucgcagauug...................GUUUGACCCGGAAUUCACUU..UCGA.CC.CU..-GU..GUUUGAUAGCCCGACCGUAGUUAUG
............................................................................................................................................................................... .................................................................................................................................................................................... .........................
AF200692.2 0.00 .AGCUCAGCGGCGAAAUACUGUACCGGUUGGUGGGGCAAGGCAAGAAGCUGUUCCGCUGGCGGCUACCCGAAGGUAAUCCCUAUCUGAGGACGGAGACCAGAAACACGUAUACAUCGCGCUUUACAGAAGUGGCAAUGGCGUUCGCCAGCAUUUAAAUG GAGAGCCGGAUGCG.C.U..GAAAGGUGCACGUCCGGUUCGG-......................GG.AGGAGaggcagggaaau........................................................AGUCCGACUACGCCCUGCCU..CUUA.CU.CU..UAC..UCAGCACAUGGCAGGGCUUCGUCUAUGUGGCGUUCAUCAUUG
.............................................................................................................................................................. .................................................................................................................................................................................... ..........................................
AF235045.1 0.00 .CAAGAAAAGGAGGGAAACGGAUACUCAAUCUAAAGUGAGUAAACAGAAUUCCAUACUCGAUCCCAUAGAUACAUAUAGAAUUCUGUG GAAAGCCGUAUUCG.A.U..GAAAGUCGUAUGUACGGCUUGG-......................AG.GGAGA....................................................................-UCUUUCAUAUCUUUCGAGA..UCCA.CC.CU..-AC..AAUAUGGGGUCAAAAAGCCAAAAUAAGUGAUUCGUUUUUAGCCCUUAUAAAACUGAUUCUUGAACCUUUUUCGCGCUCAUGUCACGUCGAGGUACUGCAGAAGAAAAAACUGC
....................................................................................... .................................................................................................................................................................................... .................................................................................................................
AF243383.1 0.00 .GUGAAUUUUUACGAACGAACAAUAA CAGAGCCGUAUACU.C.C..GAGAGGGGUACGUACGGUUCCC-......................GA.AGAGGguggugcaaaccagucacaguaa.............................................UGUGAACAAGGCGGUACCUC..CCUA.CU.UC..-AC..CAUAUUAUUUUAAAUGCCACGAAUCCAAAAACACUCAAAAAAUUUCAACAAUCUAAAAGUCAGUUAGAAGAAUUGAAAGAAAUAUCUGAUGUUAUCUCUAAAGAGUAUGGCUGUAAAAUUAUUGACCGUUCUUUAAAAAAUUCUCACAAAAAAUAUCAAGUCUAUCUUGCGAAAA
......................... .................................................................................................................................................................................... ...............................................................................................................................................................................
AF314856.1 0.00 .AAGGAAAAGGAACCAGUGACGCCUUUUCGACGAAACUUCGCUUGGUAGGCGCUGCUUACUCACCCUAUUCCCUGAGACAAUGCGCUGAACACGAAAGUUUGCAGUUCCGCCCCCUUUUCCCAUGCGGAGUCACAGGCAGCGCCUCGGAAAAAAGCACGG ACGAGCCACAUGCA.G.G..GAAACUUGCACGUGUGGUUCUG-......................GC.CGGGG....................................................................-------------ACCCCGG..UAUA.CU.GU..-AC..UAAUAUGUGUAGGUCCCUGUAAUUUGAGUGAGAUUGUCAUG
............................................................................................................................................................... .................................................................................................................................................................................... .........................................
AJ011856.1 0.00 .AUUAAUUAAUUAAUUAAUAAUAAUAACGAAUAAAUGAUUAAUGUGAAAGCAUGCUAACUUCAAUAUAGGAUGAUUUAUAUAGUAUAUAAAUUGU UUGAGCUGUAUACU.A.U..GAAAGUAGUACGUACAGUUCUGA......................GU.GGGGG....................................................................--AAAAUUUGUAAAGAUCUA..CCUA.UC.AC..AAU..UGUCACAUUGAGGUAAUAUAAAUAUCGCCUCAAAUAUAUUUAAUAUAAUAAAACUAAUUUAUAUAAUAAUGUUAAUAUUAUUAAUUUAUAUUUUUUAUACGAUUAU
.............................................................................................. .................................................................................................................................................................................... ..........................................................................................................
AJ130737.1 0.00 .GAAAAAGAAUUUUCUUUUCCGAGAUAUCUCGGAAAUAAAAAAACGAAAAAGGGAUAGAUAUUAUGAACUGGAGAUAAAGAAAUUGGGAACAAGCGAAUACGCAACUUGCAGAAUGGCAGCAGAACGCGUAGUGGGUCCAUCGGUGACCUGCUGGCUGGGGGGCCGGCCCGGCCGUCACUCUUCUUCGCCGC UUGAGCCGUAUGCG.G.G..GAAACUUGCACGUGCGGUUCUUUgag...................GG.GGGGG....................................................................AGCUUGCUCGAAAGAGCCUA..CCUA.UC.CC..GAU..UAUACCAUU
............................................................................................................................................................................................... .................................................................................................................................................................................... .........
AJ130746.1 0.00 .UGGAAACGGGCAAAUGCACAACUUACGGAGUGAUAGUAGAACACUAUGUGGGUCCAUCGGUGAACUGCUCCGGGCCAGCCGUCACUCUUCUUCGCCGC UUGAGCCGUAUGCG.AaG..GAAACUUGCACGUGCGGUUCUUUgcuuug................AG.GGGGG....................................................................--AAAGCUUGAAAGAGCCUA..UCCA.UC.CU..GAU..UAUACCAUUAGUGGUAACUUCGCUUUCCGAUCGGGAAGCGUCUCUGUCUUCUUUAUUCCCUAUCACUCUUUUCGUUUACUUUCCUUAACAUUCCUAGCACCA
.................................................................................................. .................................................................................................................................................................................... ......................................................................................................
AJ131136.1 0.00 .UGAUAGCAGAACACUACGUGGGUCCAUCGGUGACCUGCCGAGGCCGGCCCAGCCGUCACGCCGC UUGAGCCGUAUGCG.A.G..GAAACUUGCACGUGCGGUUCUUUga....................GG.GGGGA....................................................................---AAGCUUGAAAGAGCCUA..UCCA.UC.CC..GAU..UAUACCAUUAGUGGUAACUUUGCUUUCUGGUCGGGAAGCGUCUCUGUCUUCUUUACUCCCUAUCACUCUUUUCGUUUACCUUUCUUAACAUUUCCAGCACCAACUAAUUCAUUCAAGCGAGACAUCUUACGAUGCC
................................................................ .................................................................................................................................................................................... ........................................................................................................................................
AJ131144.1 0.00 .GCUAAGGCCGGCCCAGCCGUCACUCUUCUUCGCCGC UUGAGCCGUAUGCG.A.G..GAAACUUGCACGUGCGGUUCUUUgcuuug................AG.GGGGG....................................................................--AAAGCUUGAAAGAGCCUA..UCCA.UC.CU..GAU..UAUACCAUUAGUGGUAACUUCGCUUUCCGGUCGGGAAGCGUCUCUGUAUUCUUUAUUCCCUAUCACUCUUUUCGUUUACUUUCCUUAACAUUCCUAGCACCAACUAAUUCAUUCAAGCGAGACAUCUUACGAUGCCACGAUGCGCCCAUUCUUAUGGCCAUCCC
.................................... .................................................................................................................................................................................... ....................................................................................................................................................................
AJ131145.1 0.00 .ACUCUUCUUCGCCGC UUGAGCCGUAUGCG.A.G..GAAACUUGCACGUGCGGUUCUUUga....................GG.GGGGG....................................................................---AAGCUUGAAAGAGCCUA..CCCA.UC.CC..GAU..UAUACCAUUAGUGGUAACUUUGCUUUCUGGUCGGGAAGUGUCUCUGUCUUCUUUACUCCCCAUUACUCUUCCCGUUUACUUUUCUCAACAUUUCUAGCACCAACUAAUUCAUUCAAGCGAGACAUCUUACGAUGCCAUGAUGCGCCCAUUCUUAUGGCCAUCCCCAACAUCCUUUUGGCUUUCGG
............... .................................................................................................................................................................................... .........................................................................................................................................................................................
AJ131147.1 0.00 .ACCUGCUGAGGCCGUCACUCUUCUUCGCCGC UUGAGCCGUAUGCG.A.G..GAAACUUGCACGUGCGGUUCUUUg.....................AG.GGGGA....................................................................--AAAGCUUGAAAGAGCCUA..UCCA.UC.CC..GAU..UAUACCAUUAGUGGUAACUUUGUUUUCCGGUCGGGAAGCGUCUCUGUCUUCUUCACCCUCUAUCACUCUUCUCGUUUACCUUUCCUAACAUUUUCAGCAUCAACUAAUUCAUUCAAGCGAGACAUCUUACGAUGCCACGAUGCGCCCAUUCUUAUGGCCAUCCCCUUAA
............................... .................................................................................................................................................................................... .........................................................................................................................................................................
AJ251292.1 0.00 .UUAAUAAUAUAGUU AGGAGCCGUAUGCA.U.U..GAAAGAUGCACGUACGGUUCUAG......................GG.GAGAGggcuugaucuuccauuau..................................................UUUAAUAUUGGACUCGGGUU..CUUA.UC.CU..-AC..
.............. ....................................................................................................................................................................................
AJ277126.1 0.00 .UGCAUGGUUCAUUCUACCUAAUUUAUAGAUGUGAGUCUCUACUCGGU AGGAGCCGUAUGAA.U.G..GAGACAUUCACGUACGGUUUUGGa.....................GU.AGCAG....................................................................-GAUAUAUGGUAACAUGUAC..UUGA.CU.AU..AAG..CUCAUCACAUCCUGGAGCUGGAAAAGGUUCCAAGGGUUCGGCUGUUCGCCGACGAAAGUGGUACGUGAGUUGGGUUUAGAACGUCGUGAGACAGUUUGGUCCCUAUCUUCUGUGGGUGUUUGAAAAUUAAGAGGACUAAACCUUAGUACGAGA
............................................... .................................................................................................................................................................................... .........................................................................................................................................................
AJ315331.1 0.00 .CAUAUCAAGAUAAAGAAUAGGAAAGGGUCCUUAGAUUUAUUUGUGACCUCUG AGGAGCCGUAUGAG.A.U..GAAAAUCUCACGUACGGUUCUGUa.....................AU.AGCGA....................................................................UGGGCACAGUGAUGUUAUCA..UCGA.CU.AU..GAU..UAUCUAACAGUUUAAGUACAGUUGAUAUAGUGGAAGCGCAGUCAAAAUAUGGCUUUUGGGGGUGGAA
.................................................... .................................................................................................................................................................................... ...................................................................
AJ316582.1 0.00 .AAAAAGAAAGAGGACUGGAAUCUAUACAUUGAUUCACAAUUUUU UUGAACCGUAUGCA.U.C..AAAAGGCGCAUGUACGGUUCCUA......................AG.GGAUA....................................................................----------------CAAU..UUUA.CC.CU..AAU..CAACCGACUUUAUCGAGAAAGAUUACUUUUUUUAGGCCAAGGGAUUAAUAGCGAGAUUUCGAAUCAACUUAUUGGUCUUAUGGUAUAUCUCAGUAUCGAGGAUGAGACCAAAGAGCUGUAUUUGUUUAUAAACUCUCCUGGGGGCUGGGUAAUACC
............................................ .................................................................................................................................................................................... ............................................................................................................................................................
AP000397.1 0.00 .UUCGAUUCCUCUUACUCAUAAAGGGUCUUACGGUCGGGAGAACUACCUAAAACUAAAGAAAAAUAGUGCUCUUUCUAAGAGUAGGCGUG GAGAGCUUUUUGCG.G.G..GAAACUUGCAAGUACAGUUUGG-......................GG.GGAGG....................................................................--------------CGGGCG..UCGA.CC.CA..-AC..CUUAUGAGUAUUCGGACUAUAACAGUUCCGAUGAACAGUCACUCACUUUUGACAGUUAUACGAUUCCAGAAGAUGAUCCAGAAUUGGGUCAAUCACGUUUAUUAGAAGUGG
......................................................................................... .................................................................................................................................................................................... ...............................................................................................................
AP000423.1 0.00 .CGAAAUUUAUUAAAAUUUAUGCAGAGAUAACAAAAAAAAUCAAUUAUUUUUUAUUAUCAAAAGUGCUUUAUUUCUAUUAUUAAAUGUUCAUACAGUAAGACUACGAUUAAAUUUACUGAGUAUUGAAUUUGGAGUCCUAUUUAUAAGGAACCAAAGAAAUUGAGUUUUCUAUGUAUACAUAGA GAAAGCUGUGUGCA.A.U..GAAAAAUGCAAGCACGGUUUGG-......................GG.AGGGGuuuuuuaccuuuuuuuuu..................................................UCAUUUUAACAAGGAGAUUA..UCUA.CU.CC..-AU..CCGACUAGUUCCGGGUU
....................................................................................................................................................................................... .................................................................................................................................................................................... .................
AY005806.1 0.00 .AUGUGUAUGUGUAAAUACAGGUACCAUAUAUAUAUUUUAUAUGGAUAUAUGGAGUCAUUUGGUUCUUUUUAUUCUUGC UCGAGCUGGAUGAU.U.A..AAAAUUAUCAUGUCCAGUUCCCU......................CG.GGGGA....................................................................--UGGAUCUAUAAGAAUUCA..CCUA.UC.CC..AAU..AACAAAAAAACCUGACUUGAAUGAUCCUGUAUUAAGAGCUAAAUUGGCUAAAGGUAUGGGUCAUAAUUAUUAUGGAGAGCCCGCAUGGCCCAAUGAUCUUUUAUAUAUUUUUCCAGUAGUAA
.............................................................................. .................................................................................................................................................................................... ..........................................................................................................................
L36897.1 0.00 .AACACAUAAAAAUAAAUUUAAAAAUAUAGGACCUGGUAUAUAAAAUCUAUUAUUAAUGAUACUCAAUAUG GAAAGCCGUAUGAU.G.G..GAAACUAUCACGUACGGUUUGG-......................GA.AAGGCucuuuaacac..........................................................GUGGCAACAUAGGUUAAUUU..GCUA.UU.UC..-AU..UUUUAGUAGUUGGUCAUGCUGUAUUAAUGAUUUUCUGUGCGCCGUUUCGCUUAAUUUAUCACUGUAUUGAAGUGUUAAUUGAUAAACAUAUCUCUGUUUAUUCAAUUAAUGAAAACUUUACCGUAUCAUU
...................................................................... .................................................................................................................................................................................... ..................................................................................................................................
L43910.1 0.00 .GCAGGUUUGAAAAAGGAUCUUAGAGUGUCUAGGGUUGGGCCAGGAGGGUCUCUUAACGCCUUCCUUUUUCUGCCCAUCGGAGUUAUUUCCCAAGGACUUGCCAUGGUAAGAGGGAGAAGGGGGAAGAACGCACAUUG AAGAGCGCAGUACA.A.Cg.GGGAGUUGUAUGCUGCGUUCGG-......................GA.AGGAUgaaucgcucccgaaaagggagucuauugauucucuccccaauugguuggaucguagag..........CGCAGUACAAGGGGCGAUGA..UUUA.CU.UC..-AC..
......................................................................................................................................... ....................................................................................................................................................................................
M15176.1 0.00 .GUGUAUCUAUCUAUAAUAUUUUUGAAUAUUAUGGAAUUAGAGAAAUGACAUUCGCACGCUUCUCAUUUCAUUCGCG AGGAGCUGGAUGAG.A.A..GAAACUCUCAUGUCCAGUUUUGUa.....................GU.AGAGA....................................................................-UGGAACUAAGAAGGAACCA..UCGA.CU.AU..AAC..CCCAAAAGAACUAGAUUUCGUAAACAACAUAGAGGAAGAAUGAAGGGAAAAUCCUGCCGAGGCAAUCAUAUUUGUUUUGGUAGAUAUGCUCUUCAAGUACUUGAACCCGCUUGGAUCACCGCGA
............................................................................ .................................................................................................................................................................................... ............................................................................................................................
M36911.1 0.00 .GUAAUCGCAUAUUACCUUUGAUG GAGAGCCGUAUGCG.G.U..GAAAGUCGCACGUACGGUUCGG-......................AG.GAGAGuuuuugguuucuaaggucua................................................UAUAGACUAAGGACUGGCUG..CUUA.UC.CU..-AC..
....................... ....................................................................................................................................................................................
M68929.1 0.00 .UAGAGUUA GUGAGCCGUGUAAU.G.G..GCAACUAUUUCGCACGGUUCGG-......................AG.GGCACuucaguaa............................................................GCCCUACAAGGGCUGAAGUC..UUGA.CC.CC..UAU..UCCUUUUGAUGAUGCUAGAAGUCGUUUUGAUAUACGAUUUUAUCUUGUUUCUAUUUUAUUUAUUAUAUUUGAUUUGGAAGUCACCUUUUUAUUUCCUUGGGCAGUUUCUCUUAAUAAGAUUGGUUUGUUUGGAUUUUGGUCUAUGAUGGUAUUUUUAUUUAUUUUGACGAUUGGAUUUGUAUAUGAAUGGAA
........ .................................................................................................................................................................................... ................................................................................................................................................................................................
M81726.1 0.00 .AUGGGUUCCUUUUUUGUCUCGCAUUUCUCAUCGAUCGAACAGGAAAAGAAUCAUAUUUAAAAGGCUCCUCACCCAAGCCCCUCCUUCGUAGAGCCGUGUAUUGUAGGUGAUCCGGAACCUGCCCGGAGCGAGCCUUCCAUAGAGGCAAGUGAAGUUG GUGAGCCGUAUGAU.G.G..GCAACUAUCUCCUGCGGUUCGG-......................AG.AGGACucagcuguuaguuaguacccccg.............................................UCGGUUUCGGGGUGGACCCU..UUUA.CU.CU..-AU..UUUAUUAUAUACGCUUAGCGAAAAGAAUGUUUUUUGAUACACC
............................................................................................................................................................. .................................................................................................................................................................................... ...........................................
U13767.1 0.00 .AGUCAUGCCACGAUUAUCGGCAUAUGAGCAAAACCGAAAGGUAAGAACAUC GGGAGCCGUGUGCA.G.C..GAAAGUUGCACGCACGGAUCUAAcag...................AG.AGGGA....................................................................-CGGGGAAUAAUAUCCCCUC..UCGA.CU.CU..AAC..CUACGGUGAAGAUGUGGGAUGGCGAAUACGCCGUUGGGUUACAACACCUAAAGUCUUACGAUUAAUCGCCUGCUGAAUGUGAGCAGGACUUUGGACAAAAAGAAGUCCAAAUAUGUAUCUGCUGGAAUGACAAUACACGAACUACUUUU
................................................... .................................................................................................................................................................................... .....................................................................................................................................................
U41288.1 0.00 .UUUCGUG GAGAGCCGUAUGCG.G.U..GAAAGUUGCACGUACGGUUCGG-......................UG.GGAGGuuucuuau............................................................AUCCCUCGUGGAGUAGGCUA..UCGA.CC.CA..-AC..UAUUACCGCCAUCAUUAAUUUUAUUAGUUGGUUCAGCUUUUGUUGAGCAAGGAGCCGGUAAACUAGUGCCGGAUGAGCCCAAAGGGCUGAAGGACAGCCCGAAGGGCUGUUCUUGAGACCCAAUCCCCCUUCGGGGGAUUCGGGCUUUCAUUAAAUAACACUAUAUGCUGGAAAUUUACCAAGUUUUGAGUAG
....... .................................................................................................................................................................................... .................................................................................................................................................................................................
U77945.1 0.00 .GCGCAACAUAUGAACUACGCGCUGCCAAAGAAACUGUGGGACCGGCUCGGGCUGGUCUCGAUACUGGAUACGAUUAACCGGCUUAGCCGUAACCUG AACCGCCGUGUACG.-.-..GAAC--CGUACGCACGGUGGUG-......................UG.AGAGGa...................................................................CGGCGGGUGUGAAUCCGCCU..CCUA.CU.CG..-AU..
................................................................................................ ....................................................................................................................................................................................
V00166.1 0.00 .UCGGAGAAGGGCAAUGACUCAUUCUUAGUUAGAAUGGGAUUCCAACUCAGCACCUUUUGAGUGAGAUUUUGAGAAGAGUUGCUCUUUG GAGAGCACAGUACG.A.U..GAAAGUUGUAAGCUGUGUUCGG-......................GG.GGGAGuuauugucuaucguuggccucuaugguagaaucagucg..............................GGGGACCUGAGAGGCGGUGG..UUUA.CC.CU..-GC..GGCGGAUGUCAGCGGUUCGAGUCCGCUUAUCUCCAACUCGUGAACUUAGCCGAUACAAAGCUUUACGAUAGCACCCAAUUUUUCCGAUUCGGCGGUUCGAUCUAUGAUUUUA
........................................................................................ .................................................................................................................................................................................... ................................................................................................................
V00694.1 0.00 .AAAUAUAAUGGUCCAGGUUUAUAAUAAUUAUUAUACUCCUUCGGGGUCGCCGCGGGGGCGGGCCGGACUAUUAAAUAUGCGUUAAAUG GAGAGCCGUAUGAU.A.U..GAAAGUAUCACGUACGGUUCGG-......................AG.AGGGCucuuuuauaugaaugu....................................................UAUUACAUUCAGAUAGGUUU..GCUA.CU.CU..-AC..UCUUAGUAAUGCCUGCUUUAAUUGGAGGUUUUGGUAACCAAAAAAGAUAUGAAAGUAAUAAUAAUAAUAAUCAAGUAAUAGAAAAUAAAGAAUAUAAUUUAAAAUUAAAUUA
........................................................................................ .................................................................................................................................................................................... ................................................................................................................
V00712.1 0.00 .AGGCGUG GAGAGCUUUUUGCG.G.G..GAAACUUGCAAGUCAAGUUUGG-......................GG.GGAGG....................................................................--------------CGGGCG..UCGA.CC.CA.aCCU..UAUGAGUAUUCGGACUAUAACAGUUCCGAUGAACAGUCACUCACUUUUGACAGUUAUACGAUUCCAGAAGAUGAUCCAGAAUUGGGUCAAUCACGUUUAUUAGAAGUUGACAAUAGAGUGGUUGUACCAGCCAAAACUCAUCUACGUAUGAUUGUAACACCCGCUGAUGUACCUCAUAGUUGGGCUGUACCUU
....... .................................................................................................................................................................................... .................................................................................................................................................................................................
X01088.1 0.00 .UACGGUCUCAUAGAGGGGGGAGAACUACCUAACUAAAGAAGAAUAGUGCUCUUUAUAAAUAAGAGUAGGCGUG GAGAGCUUUUUGCG.G.G..GAAACUUGCAAGUAAAGUUUGG-......................GG.GGAGG....................................................................--------------CGGGCG..UCGA.CC.CA.aCCU..UAUGAGUAUUCGGACUAUAACAGUUCCGAUGAACAGUCACUCACUUUUGACAGUUAUACGAUUCCAGAAGAUGAUCCAGAAUUGGGUCAAUCACGUUUAUUAGAAGUUGACAAUAGAGUGGUUGUAC
......................................................................... .................................................................................................................................................................................... ...............................................................................................................................
X02819.1 0.00 .ACUCUUAAUGAGGAUAAAAAAGUUUAGAUAUCUUAAAUGUAGUG GAGAGCCGUAUAAUuA.C..GAAAGUAUCCCGUACGGUUCGG-......................UG.ACGAGccguguca............................................................ACCCUGCAAAGGGAAUGCGU..CUUA.GUuCA..-AU..GAUUUGAUAACAAUAUUUAUCUUCUUAAUCGGUAUAAAUUAUAUGGCAUUCUAUAAUCCAUAUGGAUUUAUGGAACCAGAUUGUGCUUUACCAGCGGAUCCUCUAAAAACUCCAAUGUCUAUUGUUCCAGAAUGGUAUUUAUUACCUUUCUAUGCU
............................................ .................................................................................................................................................................................... ............................................................................................................................................................
X03415.1 0.00 .UGAGAGUACGAAUGGUUUCUUUUUCAUUUUCAGGAAGAAAGAAGAAAAAAAAAGACUUACAUCUUUAAUUGAUUUGAUCAUUUUAUGGACCCAGUUGUCAUUUCUUAGAUAGAAUUCCAUACAGAGAUAAAACCUCGAAUCAAUCAUUUUUC UCGAGCCGUACGAG.G.A..GAAAGCUUCCUAUACGUUUCUA-......................GG.GGGGG....................................................................-----UGUUGUUCAUCUACA..UCAA.UC.CC..AAU..GAGCCGUCUAUCGAAUCGUUGCAAUUGAUGUUCGAUCCCGAAGAGAAG
........................................................................................................................................................ .................................................................................................................................................................................... ................................................
X03481.1 0.00 .GGAUCCGCAUAUGUUUGGUAAAGAGAAUAAUCUUAUCCUUUGAGAAUAAUCAAAAAUGGACAGUGUUCAAUUGGAACAUGAAAACGUGACUAAAUUGGUCCUAGUUACUCUUCGGGGCGGAGUGGAAGAAGGGGGGGAUUCUCGAACGCGGAAAGGAUCCAAUGAAUUCGAAAGAAUUGAACG AGGAGCCGUAUGAG.G.U..GAAAAUCUCAUGUACGGUUCUGU......................AG.AGUGG....................................................................CAGUAAGGGUGACUUAUCUG..UCAA.CU.UU..UCC..ACUAUCACCCCAAAAAA
....................................................................................................................................................................................... .................................................................................................................................................................................... .................
X03698.1 0.00 .UCAAAUUUUUAUGUUAAAAAAAUACAUAUAGAAGAAAAAAAGAAAAAUAAUUGAUUGAAUUUAAGAAAUAAAAUGUUAUAAACUAUAAUCAUUUGAACG AGAAGCCGUAUGAA.A.U..GAAAAUAUCAAGUACGGUUUUGU......................AA.AGUGA....................................................................CAAUUUAGGUAACUUAUUUG..UCAA.CU.UU..UCC..ACUACAACACCAAAAAAACCAAACUCUGCCU
................................................................................................... .................................................................................................................................................................................... ...............................
X03834.1 0.00 .AAAUCUCAUGUAAUAUUCAUAAAACACAUGUGUAUCCAUAAUGUAAUAUUCAUGGAAUCUUUUAUAUUGAAUUGUUUCUUCUUUCGCGAUCG GGGAGCCGGAUGAG.A.A..GAAACUCUCAUGUCCGGUUCUGUa.....................GU.AGAGA....................................................................-UGGAAUAGGGAAAUAACCA..UCAA.CU.AU..AAC..CCCAAAAGAACCAGAUUCCGUAAACAACAUAGAGGAAGAAUGAAAGGAAAAUCUUAUAGAGGCAAUCAUAUUAGUUUCGGAAGAUACGCUCUUCAAGCAGUUGAACCC
............................................................................................ .................................................................................................................................................................................... ............................................................................................................
X04336.1 0.00 .UCAGAAAGGGAGGGGUGAAAUCCACGGGUUUCACCGCAUUGAUGUCAAUGCUAAAUAGAAAACAAAUUCCGGUAUGUAAAGGAUGUCAUGUAAAAAUCCACAAAGGUCUUUACAACGAUAUGAAAUUGAAUGAAUUACACGUAAAAAAGAACAAGGAAAAAUAAAGAUAGCAUUAAUUCUUAAAGGGG GAGAGCCGUAUGCA.G.G..GAAACUUGCACGUACGGUUCGG-......................AG.GGAGGucucucguugccaguucuaaucuauugau.......................................AAGGAUCACGGUGCGGGUUA..UCGA.CC.CU..-AC..UAUUACCACCUA
............................................................................................................................................................................................ .................................................................................................................................................................................... ............
X04465.1 0.00 .AUAAAAAUGUAAAAAAAAAAUAAACAUAGAUGUUAUAAAAAUCGGUAAGUAAUUCAAAAAAUACAUGUAUUUUUUGAAUUACUUACCGAUUUUUAUAA AGGAGCCGAAUGAA.A.G..AAAACUUUCACGUUCGGUUUUGAa.....................UU.AGAGGca..................................................................UUUUUUAUUUUUAAUAAAUG..UCGA.CU.AU..AAC..CCUUAGCCUUCCAAGCUAACGAUGCGGGUUCGAUUCCCGUACCCGCUUUUCUAAAAAAGAAUUUGAAAUGAUAAAUUUUUUUGAGUUUAUCAUUUCAAAUUC
.................................................................................................. .................................................................................................................................................................................... ......................................................................................................
X05422.1 0.00 .UUCUUAUUUCAUAUCUUCAAGGCAAAUCGAUCCAAUACCGUGGCUGAUGGAGUUUUGAACCCUUUUUUUCUAAUAUCCGUUGAAAAUUUGUGUAUUUCUGC UUGAGCCGUACGAG.A.U..GAAAUUUUCAUAUACGGUUCUCG......................GA.GGGGG....................................................................------AGUCGGGCUAGUUA..CCUA.UC.UC..AAU..AAAGUAUAUGAUUGGUUUGAAGAACGUCUUGAGAUUCAGGCAAUUGCAGAUGAUAUAACUAGUAAAUAUGUUCCUCCUCAUGUCAACAUAUUUUAUUGU
..................................................................................................... .................................................................................................................................................................................... ...................................................................................................
X05917.1 0.00 .UCCAUAUUUUUAGAAAUAGAGAAAAGAGGAUAGGCUCAUUCCAUAAUAAAUAUGGGGAAAUUUCCUAUAAGGAAUUGAGUGU GAGAGCCAAAUGAA.U.U..GAAAGAUUCAUGUUUGGUUCGG-......................GA.AGAGAucauagacauuu........................................................UGAAAUGAAUGGAAAGAGAA..UCUA.CU.UU..CAU..UAAGUGAUUUAUUAGAUAAUCGAAAACAGAGAAUCUUGAGAACUAUUCGAAAUUCAGAAGAACUCCGGGAAACAGCCAUUGAACAGCUGGAAAAAGCCCGGGCCCGUUUAAGGAAAGU
.................................................................................. .................................................................................................................................................................................... ......................................................................................................................
X07106.1 0.00 .GUAAGAGCAGAAUUCUUUUCCGUGGAUAAUUACAACUUUGGAAAGUAGGAUUUAAUAAAUAGGUUCUUACAGGGAACCUUUAUAGAUGGAUAAGAUAUAUAUAUUAUGGAUCCAUUUGGUUCUUUUGAUUCUUGC UUGAGCCGGAUGAU.G.A..AAAAUUAUCAUGUCCGGUUCUU-......................UC.GGGGGauga................................................................AUUGAAUCUAUAAGAAUUCA..CCUA.UC.CU..AAU..AACAAAAAAACCUGACUUGAAUGAUCCUGUAUUAAGGGCUAAAUUAGCGAAAGGUAUGGGGCAUA
....................................................................................................................................... .................................................................................................................................................................................... .................................................................
X17375.2 0.00 .AAUAGGCUCCUUCGGGAGUGAGCGAAGCAAUUCUCUCUAUCGCCUAGUGGGUAAAAGACAGGGCAAAAAGCGAAUGCCAGUUAGUAAUAGACUGGAUAGGGUGAAUAACCUAACCUGAAAGGGUGCAGACUUGCUCAUGGGCGUGGGAAAUCAGAUUUCGUGAAUACACCAGCAUUCAAGAGUUUCCAUGC UUGAGCCGUGUGCG.G.U..GAAAGUCGCAUGCACGGUUCUAC......................UG.GGGGG....................................................................--AAAGCCUGAGAGGGCCUA..CCUA.UC.CA..ACU..UUUAUCAGC
............................................................................................................................................................................................... .................................................................................................................................................................................... .........
X17395.1 0.00 .UGUGGAACCUGGUCUUUUUCGGUUCCAGCCUCUCCCUCGAAUACAUAGGGUAGGUAGGGCUGGGUGAUAAAGGGUUCCCUCUUGCCAAUAAACUUUCCCCGGCCUUCGAUUAACCUUACUCAUAAAGGGUCUUACGGUCGGGAGAACUACCUAACUAAAGAAAAAUAGUGUUCUUUCUAAGAGUAGGCGUG GAGAGCUUUUUGCG.G.G..GAAACUUGCAAGUACAGUUUGG-......................GG.GGAGG....................................................................--------------CGGGCG..UCGA.CC.CU..-AC..CUUAUGAGU
............................................................................................................................................................................................... .................................................................................................................................................................................... .........
X55026.1 0.00 .UAUAAUGCAAACGCUUAGUAUAUUAAAAUUG GAGAGCCGUAUGAU.G.G..GAAACUAUCACGUACGGUUCGG-......................GA.AAAGGuauauau.............................................................ACUGAUAAGAGGUAUACGUA..UCUA.GU.UC..-AU..UCUCAAGUAGGUUUACAUGUAUGAUUACCUAUGGCGAUGGAAGGUCCUACUCCUGUAUCAGCAUUAAUACAUGCAGCUACUAUGGUAACUGCAGGUGUAUAUUUACUAAUGCGUAGUUCACCAUUAAUUGAAUAUAAUAGUACAGUUUUAUUAUUAUGUUUAUGAUUAG
............................... .................................................................................................................................................................................... .........................................................................................................................................................................
X57546.1 0.00 .AAUGAUUAUUUAUUAGGUAGAAUGAUUAAGAUAAAUAGAAAACAAAUUACUAUCUGUAAAACAUGUCAUUUUAAAAUUCAUCAAGGUAAAUAUAAUGGUCCAGGUUUAUAAUAAUUAUUUUAAACUAUUAAACAUGCGCUAAACG GAGAGCCGUAUGAU.A.U..GAAAGUAUCACGUACGGUUCGG-......................AG.AGGGCucucuuauaugauugu....................................................UAUUACAAUCAGAUAGGUUU..GCUA.CU.CU..-AC..UCUUAGUAAUGCCGGCAUUAAUUGGUGGUUUUGGUAACUAUAUGUUACCUUUAUU
................................................................................................................................................. .................................................................................................................................................................................... .......................................................
X60045.1 0.00 .AAAAUAGGGAGGCCUGCACGCCCUAUUUGUGAGACUACUAAGGCGGUGGUGACUCUUGGAAGGAAGAAGGGGCCUAAGCACGGAUUUUUUCGUACACUUUAGUGGCAAUCGUACCUGUUUUUCUAGGCCUGUUUGGACAUACGGUUCCCGCCGGAAGAUCAAGUUG GUGAGCCGUGUGAU.G.G..GAAACCUUCCCGCACGGUUCGG-......................AG.AGCACugaauuagaaugagagguucaccaccacaucauugcaugcaaggggagcucgcucgauucgcaaauagGUCCGACUCGUAAUUCACUU..CUGA.CU.CU..-GU..GUUCGAUAGCCCGACCGUAGUGAUGUUAAUUGUG
...................................................................................................................................................................... .................................................................................................................................................................................... ..................................
X62341.1 0.00 .CGAUUCCCCUUACUCAUAAAGGGUCUUACGGUCGGUACUAACUAAAGAAAAAGAGUCUUCUUUCUAAGAGUAGGCGUG GAGAGCUUUUUGCG.G.G..GAAACUUGCAAGUACAGUUUGG-......................GG.GGAGA....................................................................--------------CGGGCG..UCGA.CC.CA.aCCU..
.............................................................................. ....................................................................................................................................................................................
X63625.1 0.00 .UCUCCCUCUCGAAUACAUAGGGUAGGUAGGGCUGGGUGAUAAACGGUUCCCUGUUGCCAAUACAAAUUCCCCGGCCUUCGAUCCCCCUUACUCAUAAAGGGUCUUACGGUCGGGAGAACUACCUAACUAAAGAUAAAUAGUGUUCUUUCUAAGAGUAGGCGUG GAGAGCUUUUUGCG.G.G..GAAACUUGCAAGUACAGUUUGG-......................AG.GGAGG....................................................................--------------CGGGCG..UCGA.CC.CA..-AC..CUUAUGAGUAUUCGGACUAUAACAGUUCCGAUGAACA
................................................................................................................................................................... .................................................................................................................................................................................... .....................................
X71404.1 0.00 .AAAUAAAUGUGAUGUGGUAGUGAGAAGUACCCACGACUUGGGUCAAGUCAUUG AGGAGCCGUAUGAG.G.U..GAAAGUCUCAAGUACGGUUUUGA......................AG.ACCAG....................................................................CAGGAUUGGUGACAGUCUUG..CUGA.GU.UU..AAU..AACUCUCCUCAACUAUCGUGGGAUAUUUUGACCAGAGUGAAAAAUCUUUACCACCGACUCAAACCCACUGAGAAAAGAAUUAUCUUUCUGGGACAAAACAUCGAACUACAUGAAUCUUUGGUACGCCUCAUUCCCUACUGUGAAGUG
..................................................... .................................................................................................................................................................................... ...................................................................................................................................................
X72287.1 0.00 .CAUAUGGUUACCGCGGAAGAUCAAGUUG GUGAGCCGUGUGAU.G.G..GAAACCUUCCCGCACGGUUCGG-......................AG.AGCACugaauuagaaugagagguucaccaccacaucauugcaugcaaggggagcucgcucgauucgcaaauugGUCCGACUCGUAAUUCACUU..CUGA.CU.CC..-GU..
............................ ....................................................................................................................................................................................
X72616.1 0.00 .UCUUAGG AAGAGCCGUACGAG.-.-..GCAG--CUCACGUACGGUUCGG-......................GAgCCGAG....................................................................------CCCCUGCACAGGGG..CUUA.GG.UC..-AA..CACUUAUAUAAUAGCCAGUCAUCAAUUAGAAGCAGGCAAAAUGGUGAUGAAUUGCGAUUGGUCCAAACCUUCGACCAGCUCCUUCUUGCAAUCCGCCCAGAAUGACCAUCCUAAGCCCUUAUUCACUGUGUGAAGAACGGGGCAGUCCGCUGGAGUGUAGGCUUCUUGGCCACGCCCCCUGCUUAUAGAUACG
....... .................................................................................................................................................................................... .................................................................................................................................................................................................
X73671.1 0.00 .AAAUAGCUGAAUUGGUGC UUGAGCCGUAUGCG.A.U..GAAAGUUGCACGUACGGUUCUUA......................AG.AGGGG....................................................................--AAAAUGAGUGAUCAUCUA..CCUA.UU.CU..AAC..UAGAUACCCAGUACUCUUAGCUGUAAACGAUGCAGAUUAGAAAUUAGCACAUACGUUAGUUUUUAGGCAAACGCGUUAAAUCUGCCACCUGUAAAGUAUAGUCGCAUGACUGAAAUACAAAUAAUUAGACCGCCCGUGAGCAAACGGAGUGAAGCAUGUUAUUUAAUACGAUAACCCGCGUA
.................. .................................................................................................................................................................................... ......................................................................................................................................................................................
X77508.1 0.00 .GCGAAGUCCACAGUUGUUUGCCCACUGGCGUCUGAAGAUGAGAGGCGGACUUGUUUGAU GGGAGCGGUAUGAG.C.C..GAGAGGUUCACGUACCGUUCUG-......................CG.AGAGGc...................................................................UGCGGGGGAGGUUCCUGCGG..CCUA.CU.CA..-CC..UGGUAAUGAAUGAAGACGACUGCAAAAUAAGAAGAGGAAAUGCAGCAGAAUUAUUUUCAGGGAUACGGCACAUCGCUAUUAAUAUUUUGACGAAUGAUAAGGUAUUCAAGGCAGGGUUAAGACGUAAGAUGCGAAAAGCAG
........................................................... .................................................................................................................................................................................... .............................................................................................................................................
X86563.2 0.00 .UGCCCAUCGGAGUUAUUUCCCAAGGACUUGCCGUGGUAAGGGGGAGAAGGGGGAAGAAGCACACUUG AAGAGCGCAGUACA.A.Cg.GGGAGUUGUAUGCUGCGUUCGG-......................GA.AGGAUggaucgcucccgaaaaggagucuauugauucucucccaauugg.........................UUGGAUCGUAGGGGCGAUGA..UUUA.CU.UC..-AC..GGGCGAGGUCUCUGGUUCAAGUCCAGGAUGGCCCAGCUGCGCAGGGAAAAGAAUAGAAGAAGCAUCUGACUCUUUCAUGCAUACUCCACUUGGCUCGGGGGGGAUAUAGCUCAGUUGGUAGAGCUCCGCUCUU
................................................................... .................................................................................................................................................................................... .....................................................................................................................................
X97295.1 0.00 .AGACUUGCCAGGGUAAGGAAGAAGGAGGGAAUAAGCACACUUG GAGAGCGCAGUACA.A.Cg.GAGAGUUGUAUGCUGCGUUCGG-......................GA.AGGAUgaaucgcucccgaaaaggaaucuauugauucucucccaauugg.........................UUGGACCGUAGGUGCGAUGA..UUUA.CU.UC..-AC..GGGCGAGGUCUCUGGUUCAAGUCCAGGAUGGCCCAGCUGCGCCAAGGAAAAGAAUAGAAGAAGCAUCUGACUCCUUCAUGCAUGCUCCACUUGGCUCGGGGGGAUAUAGCUCAGUUGGUAGAGCUCCGCUCUUGCAAUUGGGUCGUUGCGAUUACGG
........................................... .................................................................................................................................................................................... .............................................................................................................................................................
Y08501.1 0.00 .GUCUGACUCUAUUGGUCAUAGUUUCCUGCUGUUGCGGCUGGUGCUCGUUUGCGCGCGCGUGAACCAACUCAACAAAGAAGGAAAGGAUGCCCGGGGAGGCAUCUGAGAAUGAU UCGAGCCGUAUGAA.G.G..GAAACUCUCACGUACAGUUUGUUuuuuuu................GG.GGGGGgcaggagcccgacagggucccccacugacuuggcccgggccuaaguu.....................AAAGUGAAGUGGUGGGCCUA..CCCA.UC.CC..AAC..CAGGGGUAUGCUGGGAUUCGCGAAGAGCAGCACCUUACGAUGUUCAUGACCAAUCGGAUCUUGACGUACCAGUAGGUACCAGAGGAG
................................................................................................................. .................................................................................................................................................................................... .......................................................................................
Y12731.1 0.00 .GGCCUGUUUGGACAUACGGUUCCCGCGGAAGAUCAAGUUG GUGAGCCGUGUGAU.G.G..GAAACCUUCCCGCACGGUUCGG-......................AG.AGCACuuaauuagaaugagagguucaccaccacaucauugcaugcaaggggagcucgcucgauucgcaaauagGUCCGACUCGUAAUUAACUU..CUGA.CU.CC..-GU..GUUCGAUAGCCCGACCGUAGUGAUGUUAAUUGUGGUUACAUCCAUAAGUAGCUUGGUCCAUCUUUAUUCCAUUUCAUAUAUGUCUGAGGAUCCGCAUAGCCCUCGAUUUAUGUGUUAUUUAUCCAUUCUUACUUUUUUUAUGCCAAUGUUGGUGACUGGA
........................................ .................................................................................................................................................................................... ................................................................................................................................................................
Y18999.2 0.00 .CGGUACCAGACGACGGUGCUGUUGAACGGC UUGAGCCGGAUGAG.G.G..GCGACUCUCAUGUCCGGUUCUU-......................AG.GGGAC....................................................................GGCGGCGCAGUAAUGCGCUGcuGUUA.CC.CG..-AC..GAAAACCAACGUAAGCCGAAUUAGAGUUCGUUUUACUCGUCAGCGACUGCGAAUUAACGAACUUUGAUUCGUGAGAAAGGUUUAUUGCACUGAUUUUCGGGUGUUGGUGACCUUUCCUCGCGAUAGCGGAAACGGUUUCAUAAAACGGUCGUUUUUCGAAACUAUCCAGA
.............................. .................................................................................................................................................................................... ..........................................................................................................................................................................
Z00028.1 0.00 .UGUAGCUGGAUUCCCCGGAACCACAAGAAUCCUUAGAAUGGGAUUCCAACUCAGCACCUUUUGUUUUGGGAUUUUGAGAAGAGUUGCUCUUUG GAGAGCACAGUACG.A.U..GAAAGUUGUAAGCUGUGUUCGG-......................GG.GGGAGuuauugccuaucguuguccucuaugguagaacccgucgg.............................GGAGGCCUGAGAGGCGGUGG..UUUA.CC.CU..-GU..GGCGGAUGUCAGCGGUUCGAGUCCGCUUAUCUCCAGCCCGUGAACUUAGCGGAUACUAUGAUAGCACCGAAGGUUGCCAAUUCGUCAGUUCGAUCUAUGAUUUCGCA
............................................................................................. .................................................................................................................................................................................... ...........................................................................................................
Z00044.1 0.00 .UUAACCCUAAAACUGGGAUAGAUCCAUGAGAAAUCUCAUUAGAUUUUAUUAGAUAUGGUAUAGAUCAAAAUGGGACACCAAAAGAAUUGACUG CUGAGCCGUAUGAG.G.UaaGAAAUUCUCAAGUACGGUUCUAA......................GG.GAAGG....................................................................----------AAUUGAACUA..CCUA.UU.CC..GGC..CGGGGAGAACAGGCCAUUCAACAGGGAGAUUCUGAAAUUGCAGAGGCUUGGUUCGAUCAAGCCGCUGAGUAUUGGAAACAGGCUAUAGCGCUUACUCCCGGUAAUUA
............................................................................................. .................................................................................................................................................................................... ...........................................................................................................
Z69899.1 0.00 .GUAAUCGCAUAAUACUUUUGAUG GAGAGCCGUAUGCG.G.U..GAAAGUCGCACGUACGGUUCGG-......................AG.GAGAGuuguugguuucuaagguuuc................................................UUUAGACUAAGGACUGGCUG..CUUA.UC.CU..ACA..UAACCAAUUAUAUAAUAGCAUCAUUACA
....................... .................................................................................................................................................................................... ............................
Z72500.1 0.00 .ACCCACUCGGAAAGAGAAUUGCUUAAGGAGGCAAUUAGAAAUACAAAAUAGCCGUCUAGUAUAUAUAUAUUUUUUUAAAUUGGAUUCUG GAAAGCCGUAUGAG.G.G..GAAACUUUCACGUACGGUUUGG-......................AG.GAAAGucgggaagcucuaagg....................................................UAUUUGCUAUGAACUCUCGG..CUCA.UC.CU..-AC..UGAUUUUGCCAGGUUUUGGUAUUGUUAGUCAUAUAUUAUCAACUUUUGCUAGAAAGCCUGUGUUCGGCUAUCUCGGCAUGGUGUACGGUGCGCCGUUGCGCUUGUUUUUCC
......................................................................................... .................................................................................................................................................................................... ...............................................................................................................