Seq ID Score (bits) Sequence
AB073371.1 0.00 .GCGG UCUCCUGCUUCAACAGUGCUUGGACGGAGCCCGGUGCUCGCCUGCCCUUACCG
.... ......<<.<<..<...>...>>..>.... .........<..>..>.......
AC073115.5 0.00 .GGCAGCACAUUCAGCAGUCCUGUGGAUCUG UCUCUUGCUUCAACAGUGUUUGGAUGGAACAGAUCCAGGAACUCUCUUUCUUCCAGUCUCCAGCUACCUUCCAAUCUUCUCUCCAUUUUCAACCUUCGGGAACAUCUUCUCGGUCAUCUCCUGCUUCUGGGACCAGCCAACACCAUUUUUGUAGUUAGCUCCUUCUUGCUAACCAUGAGCUCCCAGAUUUAUCAGAAUUA
.............................. ......<<.<<..<...>...>>..>.... ........<.....>..>........................................................................................................................................................
AC109352.3 0.00 .GACGCUCUUCACGUAGAGUGUCCACGG UUUCCUGUUUCAACAGUGCUUGGA-GGAACCAGGGCUUGUCCUUCACCCUGGCCUGUGGCUCACAGCCAGCCUUCCAGCACCUCCUCACCGCGCCGUGGGACCACCCCAAGGCCCCUGCCGGCUCCAGCGCUGCGCAGCCUCUGUGGCCUCGGCCUCUCCUUAGCCCCGCCAUGAGGAUCGGCGUUCUCACAGGUGCCAGAAC
........................... ......<<.<<..<...>...>>..>.... ........<.....>..>...........................................................................................................................................................
AF086786.1 0.00 .U UCGUUC--GUCCUCAGUGCAGGGC-AACAGAACUUCGGGCUCAAGAGGGUGGCAGCAGCCAUGUUGCUACAGCGUUGCCCAGUGCUUAUCCGGAGCCCCACAGCCAUCCUGGGCAAGAUGAUUAAGACUCACCAGUUCCUGAUUGGUAUUGGACGCUGUCCCAUCCUGGCCACCCAAGGAACAACCUGUUCUCAAAUCCACCUUAAGGCAACCAAGGCUG
. .............................. .....................................................<<.<...<...>....>..>...............<.....>..>............................................................................................
AF117958.1 0.00 .CCUCCUUGCCACCGCAGAUUGGCCGCUAGCCCUCCCCGAGCGCCCUGCCUCCGAGGGCCGGCGCACCAUAAAAGAAGCCGCCCUAGCCACGUCCCCUCGCAGUUCGGCGGUCCCGCGGGUCUG UCUCUUGUUUCAACAGUGUUUGGACGGAACAGAUCCGGGGACUCUCUUCCAGCCUCCGACCGCCCUCCGAUUUCCUCUCCGCUUGCAACCUCCGGGACCAUCUUCUC
........................................................................................................................... ......<<.<<..<...>...>>..>.... .............>...............................................................
AF171078.1 0.00 .GGGGGUGGGGUGGGGUGGGCGGGGCUGAGCAGGAGGCUGGGAUGAAAGCUGCUUCCCAGCCCAGCCCACAGCACUCACCGUCUU UGGUUC--GUCCUCAGUGCAGGGC-AACAG
...............<.....>.............................................................. ..............................
AF266195.1 0.00 .AGAUCGGGAAGAG AUUCUUGCUUCAACAGUGUUUGAACGGAAUUUCUUUCUUCGUCCAAAGCUUUUUCAGUCGCUYYUMAUUUUGCGACUCAGAGGAUCCGUUUUACUUGAAACACGUACUGAAUACYGUCUGCGCAGAGCUAUAUUUUU
............. ......<<.<<..<...>...>>..>.... ..................>........................................................................................
AF285177.1 0.00 .UU GUUCCUGCUUCAACAGUGCUUGGACGGAACCCGGCGCUCGUUCCCCUCCCCGGCCCGCCGCUCAGAGCCAGCCCUCGGCCACCCUCCACGCAGCGCUCUCGGACCGCCCCGAGGCCUCCGCCGCCGCCGCCCCAGCGCCGCGCAGCCGCCGCCGCCGC
.. ......<<.<<..<...>...>>..>.... .........<.....>..>.............................................................................................................
AF338763.1 0.00 .GCACGAGAGG UUACCUGCUUCAACAGUGCUUGAACGGCAACCUUCUACUCUUUCGAAGCAAUUUUUUUUUAAAAAUGAAAUUCAU
.......... ......<<.<<..<...>...>>..>.... ..................>..........................
AL034379.8 0.00 .CAUUCAUGUACAAAAAUGUUGUUGUGUAUUCUUGUUUCAAAAAGAAAAAAAUGAGACGUUCUUUGCGGAAAGUCCCUGGAG UUUCCUGGUUCAACAGUGCUUGGACGGAACCAGGCACUCGUACCCCACUCCGGCUGGCCGCCCAUAGCUAGCCCUCUGUUACCUCUUCACUGGGCCCUCUGACUGUCCCAAGGCCCCCGCCGCCACUCCAGCGCCGUGCAGCCACCGCC
................................................................................. ......<..<<..<...>...>>....... .........<.....>..>....................................................................................................
AL355837.6 0.00 .GCCAUACUUGCUUCAGACCUUUUCCUCCAGAGAUGACCAGUAUCCUAAGUUGAUGUGCAUCAUUCCAACCAUUUCUGUUUUUGGAUACUUAAACCUGUAUUCCUAAGAAAUACAGAAUAUUGUUUUAUGUGUUUAAAAAUGUGCAGUGCAUUUGGU GUUCCUGCUUCAACAGUGUUUGGAUGGAACAGAUCCAGGGACUCUCUUGGGAAAAAAAAAAAGUAUGUAACCUU
.........................................................................................................................<<.<<........>>..>...............<. ....>..>...................... ............................................
AL513423.3 0.00 .CGUUGGGG UUUCCUGCUUCAACAGUGCUUGGAUGGAACCCAGCCCUCGUCCCCUACCCCGGCCAGCCGCCCAUAGCCAGCCCUCCGUCACCUCUUCACCGCGCCCUGGGACUGCCCCAAGGCCCCCGCCGCAGCUCCAGCGCCGCGCAGCAGCCGCCGCCGCCGCCUCUCCUUAGUCACUGCCAUGACGACCGCGUCCACCUCGCAGGUGCGCCAGAACUACCACCAGGA
........ ......<<.<<..<...>...>>..>.... .........<.....>..>.............................................................................................................................................................................
AP003174.2 0.00 .GCCAUCUUCCAACAUUCAAAUGGAAAUCAUAUAGAAAAGGAAUCAGAUUUAAUUGAAAGGGUUUCAAAAAACAGAACUCACACCAAUAAGAGAAAUGGCAGGCAGAGUGUUCAGCAGUCCCAUGAAUAUG UUUCUU-CUUCAACAGUGUUUGGAUGGAACAGACCCGGGGACUCCCUCUCUUCCAGCCUCCGAGCAUCCUCCAGUCUCCUCUUCACUUGCAAACUCCGGG
.................................................................................................................................. .......<.<<..<...>...>>..>.... ........<.....>.......................................................
AY112742.1 0.00 .CAUUCGGCACG AGUCCUGCUUCAACAGUGCUUGAACGGAACCCGGCGCUCGCUCCCCGCCCCGGCCGGCCACCCAGAGUCAGCCCUCCUUCACCUCCUCACAGCGCCCUCGGCCCGCCGCAAGGCUCCCGCCGCCGCUCCAGCGCCGCCCCGCCGCCGCCGCCCUCUCCUCUCCUCAGCCGUCCGCCAUGACGACCGCGUUCCCCUCGCAGGUGCGCCAGAACUACCA
........... ......<<.<<..<...>...>>..>.... .........<.....>..>........................................................................................................................................................................
AY120878.1 0.00 .GGAGAGAGAGAGAGAACUAGUCUCGAGUUUUUUUUUUUUGUUUUUUGGU GGUCGC--GUCAACAGUGUUUGAU-CGAACACCUGUUCGUCUUUUUAACGAUUUUUUAAGAGAG
...................<............................. .....>........................ ..................................
BC001188.1 0.00 .GUUUUUACCUACCACAGUGUCUGUAUCGGAGACAGUGAUCUCCAUAUGUUACACUAAGGGUGUAAGUA AUUAUC--GGGAACAGUGUUUCCC-AUAAUUUUCUUCAUGCAAUGACAUCUUCAAAGCUUGAAGAUCGUUAGUAUCUAACAUGUAUCCCAACUCCUAUAAUUCCCUAUCUUUUAGUUUUAGUUGCAGAAACAUUUUGUGGUCAUUAAGCAUUGGGUGGGUAA
............................................................<.<..... .........>..>...............<. ....>...............................................................................................................................
BC016354.1 0.00 .CCCGCGGGUCUG UCUCUUGCUUCAACAGUGUUUGGACGGAACAGAUCCGGGGACUCUCUUCCAGCCUCCGACCGCCCUCCGAUUUCCUCUCCGCUUGCAACCUCCGGGACCAUCUUCUCGGCCAUCUCCUGCUUCUGGGACCUGCCAGCACCGUUUUUGUGGUUAGCUCCUUCUUGCCAACCAACCAUGAGCUCCCAGAUUCGUCAGAAUUAUUCCACCGACGUGGAGGC
............ ......<<.<<..<...>...>>..>.... ........<.....>..>..........................................................................................................................................................................
BC019840.1 0.00 .CGUGGAUCUG UGUCUUGCUUCAACAGUGUUUGAACGGAACAGACCCGGGGAUUCCCACUGUACUCGCUUCCAGCCGCCUUUACAAGUCUCUCCAGUCGCAGCCUCCGGGACCAUCUCCUCGCUGCCUUCAGCUCCUAGGACCAGUCUGCACCGUCUCUUCGCGGUUAGCUCCUACUCCGGAUCAGCCAUGACCUCUCAGAUUCGUCAGAAUUA
.......... ......<<.<<..<...>...>>..>.... ........<.....>..>...........................................................................................................................................................
BC021386.1 0.00 .CCACGCGUCCGCGCCCAGAGUCGCCGCGG UUUCCUGCUUCAACAGUGCUUGAACGGAACCCGGUGCU
............................. .......<.<<..<...>...>>..>.... ........
D86625.1 0.00 .GAGAA GUUCUUGUUUCAACAGUGAUUGAACGGAACUCCUCUGCCUUCGUCCCGCAUUAUAGAACAUUGAGGGUUAAUGACAUAGC
..... ......<<.<<..<...>...>>..>.... ...........<.....>..>.............................
J02723.1 0.00 .AAUCUUAUACGUCCCCCAGAUCUACACCUGACUGAGUAGA GUUCUUGCUUCAACAGUAUUUGAACGGAACCCUCUCUGAGUACUUUGCUCUUUUUUCAAACCUCUUCCAAUUGCUGAUUUUCUCUGAUAUUUUUGCGCCACCCAAAACCACCGAAAUGGCAUCCCAGGUGCGUCAGAACUACCACAGCGACUGCGAGGCUGCCGUCAACCGUAUGUUGAACUUGGAGCUG
........................................ ......<<.<<..........>>..>.... ........<.....>..>..............................................................................................................................................
J02741.1 0.00 .UGGGAGGGGCGCGAGGUUCCCCUCAGCUCGGGAUUGGUCAGGUAUACUUUUACGUCCCCACCUCACGCCACCGCCGAUUGGUUAGUCUCGGGCCUCGGACACCCCGCCCUCCGGAGGCCAGCAUACUAUAAAAGGAGCGGUCCUCGCGCUCUUAUCUGAGCAGCGCUUUGGAGAUCCCGAGGAUCUG UAUCUUGCUUCAACAGUGUUUGGACGGAACAGACCCGGGGACU
...................................................................<<..<...>...>>...............<.....>.................................................................................... .............................. .............
J04755.1 0.00 .GAUAGGGUAAAAGUGGAAGAAUGACAAAAGAAGAGACAUUCUUCACCAAGAGUCCUCGGGG UUUCCUGCUUCAGCAGUGCUUGGACGGAACCCGGCACUUGUCCCCCACCCAGGCCAGCUGCCCAUAGCCAGCCCUCCGUCACGUCUUCACUGCACCCUCAGACCACCCCAAGGCCCCCACCGCCGCUCCAGCGCCACGCAGCCACCGCCGCCGCAGCCUCUCCUUAGUC
............................................................. ......<<.<<..<...>...>>..>.... .........<.....>..>........................................................................................................................
L39879.1 0.00 .CUCCUCCGGAGGGUCAACAUGCUAUAAAAGGAGCGCUCCUUGCCCGGGAGUUAGAGCAGCGCCUUGGAGGUCCCGUGGAUCUGU GUACUUGCUUCAACAGUGUUUGAACGGAACAGACCCGGGGAUUCCCACUGUACUCGCUUCCAGCCGCCUUUACAAGUCUCUCCAGUCGCAGCCUCCGGGACCAUCUCCUCGCUGCCUUCAGCUCCUAGGACCAGUCUGCACCGUCU
.................................................................................... ......<<.<<..<...>...>>..>.... ........<.....>..>..................................................................................................
M12120.1 0.00 .UUAGUAGA GUUCUUGCUUCAACAGUGUUUGAACGGAACCCUCUCUGAGUCCUUUGCUCUUUUACUUUUGAAACAUCUAUUGCAUUACUGAUUUUUUUGCGCCACCCAAAACCACCAAACCGCUGAAAUGGAUUCCCAGGUCCGCCAGAACUUCCACCGCGACUGCGAGGCUGCCAUCAACCGUAUGGUGAACAUGGAGCUGUACGCCUCCUACACCUACCUCUCCAUGGC
........ ......<<.<<..<...>...>>..>.... ........<.....>..>..............................................................................................................................................................................
M16343.1 0.00 .ACGCUGCGGCGGUAUAAAAGCGGCUGCGCGGCGCGGCUGCUCCCAGAGCGCGUCGGCGAGGCUGAGCGGAGCGG GUUCCUGCGUCAACAGUGCUUGGACGGAACCGGCCGCGCUCGGGCCCGCCGCCUCCCCCGACCGCCACCGCAGCAGCCGUCGUAUCCACCGCAUCUCUCUCUUUCUCUCCCGCCAGCGCCAUGGCUACGCCUCCUUCCCAGGUGCGCCAGAACUAC
.......................................................................... ......<<.<<..<...>...>>..>.... ..................>...........................................................................................................
S57280.1 0.00 .ACUUUGGGUUUUAUCUCUAGCAAGGAAGGGACUGAGAUACCUUUGGGGCCAAUGCAGGCCCAGGCCCGCAGAAGGCAGGGUGGGUGGGGCUGAGUCAGAGGGAGAAGGGAUAAAUGCCAGGUCCUAACCCAAGUACCCACCUGUCGU UCGUUC--GUCCUCAGUGCAGGGC-AAUAGGUA
.............................................<<.....<...>.......>...............<.....>..>......................................................... .............................. ...
S77386.1 0.00 .UGGCCAAGUCGGCCAGCGCAUGAAGAA GUUCUUGCUUCAACAGUGAUUGAACGGAACUCCUCUGCCUUCGUCCCGCACUAUAGAACAUUCCGGAUUGAUAAGGUAACACUAACUUUAACUGUAAUAGCAAAAUAGUCGAAGGAACUUUAUUUUUCUACACUUUAU
........................... ......<<.<<..<...>...>>..>.... ...........<.....>..>.......................................................................................
X03744.1 0.00 .G UCUUGC--UUCAACAGUGUUUGGACGGAAGAGAUCCUGGGACUUCCUCUCUUCCAGCCUCUCACUAUCAAUCUCCUCUCCACUUGCAACCU
. .....<...<<..<...>...>>..>.... ........<.....>..............................................