Seq ID Score (bits) Sequence
AB073371.1 0.00 UCUCCUGCUUCAACAGUGCUUGGACGGAGC
........<<<<<<...>.>>>>>......
AC073115.5 0.00 UCUCUUGCUUCAACAGUGUUUGGAUGGAAC
........<<<<<<...>.>>>>>......
AC109352.3 0.00 UUUCCUGUUUCAACAGUGCUUGGA-GGAAC
........<<<<<<...>.>>>>>......
AF086786.1 0.00 UCGUUC--GUCCUCAGUGCAGGGC-AACAG
........<<<<<<...>.>>>>>......
AF117958.1 0.00 UCUCUUGUUUCAACAGUGUUUGGACGGAAC
........<<<<<<...>.>>>>>......
AF171078.1 0.00 UGGUUC--GUCCUCAGUGCAGGGC-AACAG
........<<<<<<...>.>>>>>......
AF266195.1 0.00 AUUCUUGCUUCAACAGUGUUUGAACGGAAU
........<<<<<<...>.>>>>>......
AF285177.1 0.00 GUUCCUGCUUCAACAGUGCUUGGACGGAAC
........<<<<<<...>.>>>>>......
AF338763.1 0.00 UUACCUGCUUCAACAGUGCUUGAACGGCAA
........<<<<<<...>.>>>>>......
AL034379.8 0.00 UUUCCUGGUUCAACAGUGCUUGGACGGAAC
........<<<<<<...>.>>>>>......
AL355837.6 0.00 GUUCCUGCUUCAACAGUGUUUGGAUGGAAC
........<<<<<<...>.>>>>>......
AL513423.3 0.00 UUUCCUGCUUCAACAGUGCUUGGAUGGAAC
........<<<<<<...>.>>>>>......
AP003174.2 0.00 UUUCUU-CUUCAACAGUGUUUGGAUGGAAC
........<<<<<<...>.>>>>>......
AY112742.1 0.00 AGUCCUGCUUCAACAGUGCUUGAACGGAAC
........<<<<<<...>.>>>>>......
AY120878.1 0.00 GGUCGC--GUCAACAGUGUUUGAU-CGAAC
........<<<<<<...>.>>>>>......
BC001188.1 0.00 AUUAUC--GGGAACAGUGUUUCCC-AUAAU
........<.<<<<...>.>>>>.......
BC016354.1 0.00 UCUCUUGCUUCAACAGUGUUUGGACGGAAC
........<<<<<<...>.>>>>>......
BC019840.1 0.00 UGUCUUGCUUCAACAGUGUUUGAACGGAAC
........<<<<<<...>.>>>>>......
BC021386.1 0.00 UUUCCUGCUUCAACAGUGCUUGAACGGAAC
........<<<<<<...>.>>>>>......
D86625.1 0.00 GUUCUUGUUUCAACAGUGAUUGAACGGAAC
........<<<<<<...>.>>>>>......
J02723.1 0.00 GUUCUUGCUUCAACAGUAUUUGAACGGAAC
........<<<<<......>>>>>......
J02741.1 0.00 UAUCUUGCUUCAACAGUGUUUGGACGGAAC
........<<<<<<...>.>>>>>......
J04755.1 0.00 UUUCCUGCUUCAGCAGUGCUUGGACGGAAC
........<<<<<<...>.>>>>>......
L39879.1 0.00 GUACUUGCUUCAACAGUGUUUGAACGGAAC
........<<<<<<...>.>>>>>......
M12120.1 0.00 GUUCUUGCUUCAACAGUGUUUGAACGGAAC
........<<<<<<...>.>>>>>......
M16343.1 0.00 GUUCCUGCGUCAACAGUGCUUGGACGGAAC
.........<<<<<...>.>>>>.......
S57280.1 0.00 UCGUUC--GUCCUCAGUGCAGGGC-AAUAG
........<<<<<<...>.>>>>>......
S77386.1 0.00 GUUCUUGCUUCAACAGUGAUUGAACGGAAC
........<<<<<<...>.>>>>>......
X03744.1 0.00 UCUUGC--UUCAACAGUGUUUGGACGGAAG
........<<<<<<...>.>>>>>......