Seq ID Score (bits) Sequence
AB073371.1 43.62 UCUCCUGCUUCAACAGUGCUUGGACGGAGC
.<<<<.<.<<<<<......>>>>>>>>>>.
AC073115.5 42.18 UCUCUUGCUUCAACAGUGUUUGGAUGGAAC
..<<<.<.<<<<<......>>>>>>>>>..
AC109352.3 36.50 UUUCCUGUUUCAACAGUGCUUGGA-GGAAC
.<<<<...<<<<<......>>>>>.>>>>.
AF086786.1 21.66 UCGUUC--GUCCUCAGUGCAGGGC-AACAG
<...<...<<<<<......>>>>>.>..>.
AF117958.1 41.87 UCUCUUGUUUCAACAGUGUUUGGACGGAAC
..<<<.<.<<<<<......>>>>>>>>>..
AF171078.1 22.52 UGGUUC--GUCCUCAGUGCAGGGC-AACAG
<<..<...<<<<<......>>>>>.>.>>.
AF266195.1 44.51 AUUCUUGCUUCAACAGUGUUUGAACGGAAU
<<<<<.<.<<<<<......>>>>>>>>>>>
AF285177.1 46.51 GUUCCUGCUUCAACAGUGCUUGGACGGAAC
<<<<<.<.<<<<<......>>>>>>>>>>>
AF338763.1 38.94 UUACCUGCUUCAACAGUGCUUGAACGGCAA
<<.<<.<.<<<<<......>>>>>>>>.>>
AL034379.8 43.09 UUUCCUGGUUCAACAGUGCUUGGACGGAAC
.<<<<.<.<<<<<......>>>>>>>>>>.
AL355837.6 44.22 GUUCCUGCUUCAACAGUGUUUGGAUGGAAC
<<<<<.<.<<<<<......>>>>>>>>>>>
AL513423.3 44.39 UUUCCUGCUUCAACAGUGCUUGGAUGGAAC
.<<<<.<.<<<<<......>>>>>>>>>>.
AP003174.2 39.52 UUUCUU-CUUCAACAGUGUUUGGAUGGAAC
.<<<<...<<<<<......>>>>>.>>>>.
AY112742.1 40.20 AGUCCUGCUUCAACAGUGCUUGAACGGAAC
..<<<.<.<<<<<......>>>>>>>>>..
AY120878.1 30.47 GGUCGC--GUCAACAGUGUUUGAU-CGAAC
<.<<<...<<<<<......>>>>>.>>>.>
BC001188.1 20.38 AUUAUC--GGGAACAGUGUUUCCC-AUAAU
<<<<<...<<<<<......>>>>>.>>>>>
BC016354.1 44.57 UCUCUUGCUUCAACAGUGUUUGGACGGAAC
..<<<.<.<<<<<......>>>>>>>>>..
BC019840.1 43.98 UGUCUUGCUUCAACAGUGUUUGAACGGAAC
..<<<.<.<<<<<......>>>>>>>>>..
BC021386.1 46.20 UUUCCUGCUUCAACAGUGCUUGAACGGAAC
.<<<<.<.<<<<<......>>>>>>>>>>.
D86625.1 41.23 GUUCUUGUUUCAACAGUGAUUGAACGGAAC
<<<<<.<.<<<<<......>>>>>>>>>>>
J02723.1 42.39 GUUCUUGCUUCAACAGUAUUUGAACGGAAC
<<<<<.<.<<<<<......>>>>>>>>>>>
J02741.1 43.08 UAUCUUGCUUCAACAGUGUUUGGACGGAAC
..<<<.<.<<<<<......>>>>>>>>>..
J04755.1 43.09 UUUCCUGCUUCAGCAGUGCUUGGACGGAAC
.<<<<.<.<<<<<......>>>>>>>>>>.
L39879.1 41.58 GUACUUGCUUCAACAGUGUUUGAACGGAAC
<<.<<.<.<<<<<......>>>>>>>>.>>
M12120.1 46.25 GUUCUUGCUUCAACAGUGUUUGAACGGAAC
<<<<<.<.<<<<<......>>>>>>>>>>>
M16343.1 42.06 GUUCCUGCGUCAACAGUGCUUGGACGGAAC
<<<<<.<..<<<<......>>>>.>>>>>>
S57280.1 21.66 UCGUUC--GUCCUCAGUGCAGGGC-AAUAG
<...<...<<<<<......>>>>>.>..>.
S77386.1 43.93 GUUCUUGCUUCAACAGUGAUUGAACGGAAC
<<<<<.<.<<<<<......>>>>>>>>>>>
X03744.1 37.29 UCUUGC--UUCAACAGUGUUUGGACGGAAG
<<<.<...<<<<<......>>>>>>>>>._