Seq ID Score (bits) Sequence
AB073371.1 0.00 UCUCCUGCUUCAACAGUGCUUGGACGGAGC
..<<.<<.>........>...>>.<>....
AC073115.5 0.00 UCUCUUGCUUCAACAGUGUUUGGAUGGAAC
..<<.<<.>........>...>>.<>....
AC109352.3 0.00 UUUCCUGUUUCAACAGUGCUUGGA-GGAAC
..<<.<<.>........>...>>.......
AF086786.1 0.00 UCGUUC--GUCCUCAGUGCAGGGC-AACAG
<<<<<...>........>>..>>.......
AF117958.1 0.00 UCUCUUGUUUCAACAGUGUUUGGACGGAAC
..<<.<<.>........>...>>.<>....
AF171078.1 0.00 UGGUUC--GUCCUCAGUGCAGGGC-AACAG
<.<<<...>........>>...>.......
AF266195.1 0.00 AUUCUUGCUUCAACAGUGUUUGAACGGAAU
<><<.<<.>........>...>>.<>.<.>
AF285177.1 0.00 GUUCCUGCUUCAACAGUGCUUGGACGGAAC
<><<.<<.>........>...>>.<>....
AF338763.1 0.00 UUACCUGCUUCAACAGUGCUUGAACGGCAA
...<.<<.>........>...>..<>....
AL034379.8 0.00 UUUCCUGGUUCAACAGUGCUUGGACGGAAC
..<<.<<.>........>...>>.<>....
AL355837.6 0.00 GUUCCUGCUUCAACAGUGUUUGGAUGGAAC
<><<.<<.>........>...>>.<>....
AL513423.3 0.00 UUUCCUGCUUCAACAGUGCUUGGAUGGAAC
..<<.<<.>........>...>>.<>....
AP003174.2 0.00 UUUCUU-CUUCAACAGUGUUUGGAUGGAAC
..<<.<...........>...>>.<>....
AY112742.1 0.00 AGUCCUGCUUCAACAGUGCUUGAACGGAAC
..<<.<<.>........>...>>.<>....
AY120878.1 0.00 GGUCGC--GUCAACAGUGUUUGAU-CGAAC
...<.............>.......<>...
BC001188.1 0.00 AUUAUC--GGGAACAGUGUUUCCC-AUAAU
....<...>..................<.>
BC016354.1 0.00 UCUCUUGCUUCAACAGUGUUUGGACGGAAC
..<<.<<.>........>...>>.<>....
BC019840.1 0.00 UGUCUUGCUUCAACAGUGUUUGAACGGAAC
<><<.<<.>........>...>>.<>....
BC021386.1 0.00 UUUCCUGCUUCAACAGUGCUUGAACGGAAC
..<<.<<.>........>...>>.<>....
D86625.1 0.00 GUUCUUGUUUCAACAGUGAUUGAACGGAAC
<><<<<<.>........>>..>>.<>....
J02723.1 0.00 GUUCUUGCUUCAACAGUAUUUGAACGGAAC
<><<.<<.>........>...>>.<>....
J02741.1 0.00 UAUCUUGCUUCAACAGUGUUUGGACGGAAC
<><<.<<.>........>...>>.<>....
J04755.1 0.00 UUUCCUGCUUCAGCAGUGCUUGGACGGAAC
..<<.<<.>........>...>>.<>....
L39879.1 0.00 GUACUUGCUUCAACAGUGUUUGAACGGAAC
<>.<.<<.>........>...>..<>....
M12120.1 0.00 GUUCUUGCUUCAACAGUGUUUGAACGGAAC
<><<.<<.>........>...>>.<>....
M16343.1 0.00 GUUCCUGCGUCAACAGUGCUUGGACGGAAC
<><<.<...........>...>>.<>....
S57280.1 0.00 UCGUUC--GUCCUCAGUGCAGGGC-AAUAG
<<<<<...>........>>..>>.......
S77386.1 0.00 GUUCUUGCUUCAACAGUGAUUGAACGGAAC
<><<<<<.>........>>..>>.<>....
X03744.1 0.00 UCUUGC--UUCAACAGUGUUUGGACGGAAG
<<.<<...>........>...>>.<>....