Seq ID Score (bits) Sequence
AB073371.1 0.00 UCUCCUGCUUCAACAGUGCUUGGACGGAGC
..............................
AC073115.5 0.00 UCUCUUGCUUCAACAGUGUUUGGAUGGAAC
..............................
AC109352.3 0.00 UUUCCUGUUUCAACAGUGCUUGGA-GGAAC
..............................
AF086786.1 0.00 UCGUUC--GUCCUCAGUGCAGGGC-AACAG
..<...............>...........
AF117958.1 0.00 UCUCUUGUUUCAACAGUGUUUGGACGGAAC
..............................
AF171078.1 0.00 UGGUUC--GUCCUCAGUGCAGGGC-AACAG
..<...............>...........
AF266195.1 0.00 AUUCUUGCUUCAACAGUGUUUGAACGGAAU
<............................>
AF285177.1 0.00 GUUCCUGCUUCAACAGUGCUUGGACGGAAC
<............................>
AF338763.1 0.00 UUACCUGCUUCAACAGUGCUUGAACGGCAA
<............................>
AL034379.8 0.00 UUUCCUGGUUCAACAGUGCUUGGACGGAAC
..............................
AL355837.6 0.00 GUUCCUGCUUCAACAGUGUUUGGAUGGAAC
<............................>
AL513423.3 0.00 UUUCCUGCUUCAACAGUGCUUGGAUGGAAC
..............................
AP003174.2 0.00 UUUCUU-CUUCAACAGUGUUUGGAUGGAAC
..............................
AY112742.1 0.00 AGUCCUGCUUCAACAGUGCUUGAACGGAAC
..............................
AY120878.1 0.00 GGUCGC--GUCAACAGUGUUUGAU-CGAAC
.......................<...>..
BC001188.1 0.00 AUUAUC--GGGAACAGUGUUUCCC-AUAAU
<............................>
BC016354.1 0.00 UCUCUUGCUUCAACAGUGUUUGGACGGAAC
..............................
BC019840.1 0.00 UGUCUUGCUUCAACAGUGUUUGAACGGAAC
..............................
BC021386.1 0.00 UUUCCUGCUUCAACAGUGCUUGAACGGAAC
..............................
D86625.1 0.00 GUUCUUGUUUCAACAGUGAUUGAACGGAAC
<...<.............>..........>
J02723.1 0.00 GUUCUUGCUUCAACAGUAUUUGAACGGAAC
<............................>
J02741.1 0.00 UAUCUUGCUUCAACAGUGUUUGGACGGAAC
..............................
J04755.1 0.00 UUUCCUGCUUCAGCAGUGCUUGGACGGAAC
..............................
L39879.1 0.00 GUACUUGCUUCAACAGUGUUUGAACGGAAC
<............................>
M12120.1 0.00 GUUCUUGCUUCAACAGUGUUUGAACGGAAC
<............................>
M16343.1 0.00 GUUCCUGCGUCAACAGUGCUUGGACGGAAC
<............................>
S57280.1 0.00 UCGUUC--GUCCUCAGUGCAGGGC-AAUAG
..<...............>...........
S77386.1 0.00 GUUCUUGCUUCAACAGUGAUUGAACGGAAC
<...<.............>..........>
X03744.1 0.00 UCUUGC--UUCAACAGUGUUUGGACGGAAG
..............................