Seq ID Score (bits) Sequence
AB073371.1 0.00 UCUCCUGCUUCAACAGUGCUUGGACGGAGC
....<<<.<<<<<......>>>>>>>>...
AC073115.5 0.00 UCUCUUGCUUCAACAGUGUUUGGAUGGAAC
....<<<.<<<<<......>>>>>>>>...
AC109352.3 0.00 UUUCCUGUUUCAACAGUGCUUGGA-GGAAC
....<<..<<<<<......>>>>>.>>...
AF086786.1 0.00 UCGUUC--GUCCUCAGUGCAGGGC-AACAG
..<<<...<<<<<......>>>>>.>>>..
AF117958.1 0.00 UCUCUUGUUUCAACAGUGUUUGGACGGAAC
....<<<.<<<<<......>>>>>>>>...
AF171078.1 0.00 UGGUUC--GUCCUCAGUGCAGGGC-AACAG
..<<<...<<<<<......>>>>>.>>>..
AF266195.1 0.00 AUUCUUGCUUCAACAGUGUUUGAACGGAAU
....<<<.<<<<<......>>>>>>>>...
AF285177.1 0.00 GUUCCUGCUUCAACAGUGCUUGGACGGAAC
....<<<.<<<<<......>>>>>>>>...
AF338763.1 0.00 UUACCUGCUUCAACAGUGCUUGAACGGCAA
....<<<.<<<<<......>>>>>>>>...
AL034379.8 0.00 UUUCCUGGUUCAACAGUGCUUGGACGGAAC
....<<<.<<<<<......>>>>>>>>...
AL355837.6 0.00 GUUCCUGCUUCAACAGUGUUUGGAUGGAAC
....<<<.<<<<<......>>>>>>>>...
AL513423.3 0.00 UUUCCUGCUUCAACAGUGCUUGGAUGGAAC
....<<<.<<<<<......>>>>>>>>...
AP003174.2 0.00 UUUCUU-CUUCAACAGUGUUUGGAUGGAAC
....<<..<<<<<......>>>>>.>>...
AY112742.1 0.00 AGUCCUGCUUCAACAGUGCUUGAACGGAAC
....<<<.<<<<<......>>>>>>>>...
AY120878.1 0.00 GGUCGC--GUCAACAGUGUUUGAU-CGAAC
..<<<...<<<<<......>>>>>.>>>..
BC001188.1 0.00 AUUAUC--GGGAACAGUGUUUCCC-AUAAU
........<.<<<......>>>>.......
BC016354.1 0.00 UCUCUUGCUUCAACAGUGUUUGGACGGAAC
....<<<.<<<<<......>>>>>>>>...
BC019840.1 0.00 UGUCUUGCUUCAACAGUGUUUGAACGGAAC
....<<<.<<<<<......>>>>>>>>...
BC021386.1 0.00 UUUCCUGCUUCAACAGUGCUUGAACGGAAC
....<<<.<<<<<......>>>>>>>>...
D86625.1 0.00 GUUCUUGUUUCAACAGUGAUUGAACGGAAC
....<<<.<<<<<......>>>>>>>>...
J02723.1 0.00 GUUCUUGCUUCAACAGUAUUUGAACGGAAC
....<<<.<<<<<......>>>>>>>>...
J02741.1 0.00 UAUCUUGCUUCAACAGUGUUUGGACGGAAC
....<<<.<<<<<......>>>>>>>>...
J04755.1 0.00 UUUCCUGCUUCAGCAGUGCUUGGACGGAAC
....<<<.<<<<<......>>>>>>>>...
L39879.1 0.00 GUACUUGCUUCAACAGUGUUUGAACGGAAC
....<<<.<<<<<......>>>>>>>>...
M12120.1 0.00 GUUCUUGCUUCAACAGUGUUUGAACGGAAC
....<<<.<<<<<......>>>>>>>>...
M16343.1 0.00 GUUCCUGCGUCAACAGUGCUUGGACGGAAC
....<<<..<<<<......>>>>.>>>...
S57280.1 0.00 UCGUUC--GUCCUCAGUGCAGGGC-AAUAG
..<<<...<<<<<......>>>>>.>>>..
S77386.1 0.00 GUUCUUGCUUCAACAGUGAUUGAACGGAAC
....<<<.<<<<<......>>>>>>>>...
X03744.1 0.00 UCUUGC--UUCAACAGUGUUUGGACGGAAG
..<<<...<<<<<......>>>>>>>>...