Seq ID Score (bits) Sequence
AB073371.1 37.37 .GCGG UCUCCUGCUUCAACAGUGCUUGGACGGAGCCCGG
..<< <.<<<...<<<<<......>>>>>.>>>>> >...
AC073115.5 54.87 .UGGAUCUG UCUCUUGCUUCAACAGUGUUUGGAUGGAACAGAUCCA
.<<<<<<< <.<<<...<<<<<......>>>>>.>>>>> >>>>>>.
AC109352.3 37.32 .GUCCACGG UUUCCUGUUUCAACAGUGCUUGGA-GGAACCAGGGC
.<<<..<< <.<<<...<<<<<......>>>>>.>>>>> >.>>>.
AF086786.1 16.52 .U UCGUUC--GUCCUCAGUGCAGGGC-AACAGAA
. <<<<<...<<<<<......>>>>>.>>>.> >.
AF117958.1 52.22 .CGGGUCUG UCUCUUGUUUCAACAGUGUUUGGACGGAACAGAUCCG
.<<<<<<< <.<<<...<<<<<......>>>>>.>>>>> >>>>>>.
AF171078.1 13.33 .U UGGUUC--GUCCUCAGUGCAGGGC-AACAG
. ..<<<...<<<<<......>>>>>.>>>..
AF266195.1 47.35 .GGAAGAG AUUCUUGCUUCAACAGUGUUUGAACGGAAUUUCUUUC
.<<<<<< <<<<<...<<<<<......>>>>>.>>>>> >>>>>>.
AF285177.1 38.81 .U GUUCCUGCUUCAACAGUGCUUGGACGGAACCCG
. <<<<<...<<<<<......>>>>>.>>>>> ...
AF338763.1 40.79 .ACGAGAGG UUACCUGCUUCAACAGUGCUUGAACGGCAACCUUCUA
..<<<.<< <<.<<...<<<<<......>>>>>.>>.>> >>>>>..
AL034379.8 42.95 .UCCCUGGaG UUUCCUGGUUCAACAGUGCUUGGACGGAACCAGGCA
..<<<.<.< <.<<<...<<<<<......>>>>>.>>>>> >>>>..
AL355837.6 46.12 .UGCAUuugGU GUUCCUGCUUCAACAGUGUUUGGAUGGAACAGAUCCA
.<.<<....< <<<<<...<<<<<......>>>>>.>>>>> >.>>.>.
AL513423.3 47.10 .CGUUGGGG UUUCCUGCUUCAACAGUGCUUGGAUGGAACCCAGCC
.<<<<.<< <.<<<...<<<<<......>>>>>.>>>>> >>>>>.
AP003174.2 43.25 .UGAAUAUG UUUCUU-CUUCAACAGUGUUUGGAUGGAACAGACCCG
.<..<.<< <<<<....<<<<<......>>>>>.>>>>> >.>..>.
AY112742.1 38.59 .GGCaCG AGUCCUGCUUCAACAGUGCUUGAACGGAACCCGGCG
.<<.<< .<<<<...<<<<<......>>>>>.>>>.> .>>>>.
AY120878.1 27.43 .UUGUUuuuuGGU GGUCGC--GUCAACAGUGUUUGAU-CGAACACCuguucgucuuuuuAACGA
.<<<<....<<< <.<<....<<<<<......>>>>>..>>.> >>>.............>>>>.
BC001188.1 18.09 .GUAAGuA AUUAUC--GGGAACAGUGUUUCCC-AUAAUUuuCUUCA
..<<<.< <<<<<...<<<<<......>>>>>.>>>>> >..>>>..
BC016354.1 54.92 .CGGGUCUG UCUCUUGCUUCAACAGUGUUUGGACGGAACAGAUCCG
.<<<<<<< <.<<<...<<<<<......>>>>>.>>>>> >>>>>>.
BC019840.1 55.00 .UGGAUCUG UGUCUUGCUUCAACAGUGUUUGAACGGAACAGACCCG
.<<.<<<< <.<<<...<<<<<......>>>>>.>>>>> >>>.>>.
BC021386.1 51.48 .CGCCGCGG UUUCCUGCUUCAACAGUGCUUGAACGGAACCCGGUG
.<<<<.<< <.<<<...<<<<<......>>>>>.>>>>> >>>>>.
D86625.1 42.32 .GAGAA GUUCUUGUUUCAACAGUGAUUGAACGGAACUCCUCUG
.<<.< <<<<<...<<<<<......>>>>>.>>>>> >.>>...
J02723.1 43.66 .CUGAGuAGa GUUCUUGCUUCAACAGUAUUUGAACGGAACcCUCUCUG
..<<<.<<. <<<<<...<<<<<......>>>>>.>>>>> .>>>>>..
J02741.1 52.64 .AGGAUCUG UAUCUUGCUUCAACAGUGUUUGGACGGAACAGACCCG
.<<.<<<< <.<<<...<<<<<......>>>>>.>>>>> >>>.>>.
J04755.1 44.36 .CCUCGGGG UUUCCUGCUUCAGCAGUGCUUGGACGGAACCCGGCA
..<<<.<< <.<<<...<<<<<......>>>>>.>>>>> >>>>..
L39879.1 50.71 .UGGAUCUGU GUACUUGCUUCAACAGUGUUUGAACGGAACAGACCCG
.<<.<<<<< .<.<<...<<<<<......>>>>>.>>>>> >>>.>>.
M12120.1 45.37 .UAGuAGa GUUCUUGCUUCAACAGUGUUUGAACGGAACcCUCUCUG
.<<.<<. <<<<<...<<<<<......>>>>>.>>>>> .>>>>...
M16343.1 40.32 .GGAGCGG GUUCCUGCGUCAACAGUGCUUGGACGGAACCGGCCGC
...<<.< <<<<<....<<<<......>>>>..>>>>> >.>>...
S57280.1 14.52 .UCGU UCGUUC--GUCCUCAGUGCAGGGC-AAUAGGUA
...< <.<<<...<<<<<......>>>>>.>>>>> ...
S77386.1 49.59 .UGAAGAA GUUCUUGCUUCAACAGUGAUUGAACGGAACUCCUCUG
.<.<<.< <<<<<...<<<<<......>>>>>.>>>>> >.>>.>.
X03744.1 27.21 .G UCUUGC--UUCAACAGUGUUUGGACGGAAGAG
. <<<.....<<<<<......>>>>>.>>>.. ..