Seq ID Score (bits) Sequence
AB073371.1 0.00 UCUCCUGCUUCAACAGUGCUUGGACGGAGC
___.<<..<<<<.......>.>>>.>>.__
AC073115.5 0.00 UCUCUUGCUUCAACAGUGUUUGGAUGGAAC
___.<<..<<<<.......>.>>>.>>.__
AC109352.3 0.00 UUUCCUGUUUCAACAGUGCUUGGA-GGAAC
___.<<..<<<<.......>.>>>.>>.__
AF117958.1 0.00 UCUCUUGUUUCAACAGUGUUUGGACGGAAC
___.<<..<<<<.......>.>>>.>>.__
AF171078.1 0.00 UGGUUC--GUCCUCAGUGCAGGGC-AACAG
_.<<....<<<<........>>>>..>>._
AF266195.1 0.00 AUUCUUGCUUCAACAGUGUUUGAACGGAAU
___.<<..<<<<.......>.>>>.>>.__
AF285177.1 0.00 GUUCCUGCUUCAACAGUGCUUGGACGGAAC
___.<<..<<<<.......>.>>>.>>.__
AF338763.1 0.00 UUACCUGCUUCAACAGUGCUUGAACGGCAA
___.<<..<<<<.......>.>>>.>>.__
AL034379.8 0.00 UUUCCUGGUUCAACAGUGCUUGGACGGAAC
___.<<..<<<<.......>.>>>.>>.__
AL355837.6 0.00 GUUCCUGCUUCAACAGUGUUUGGAUGGAAC
___.<<..<<<<.......>.>>>.>>.__
AL513423.3 0.00 UUUCCUGCUUCAACAGUGCUUGGAUGGAAC
___.<<..<<<<.......>.>>>.>>.__
AP003174.2 0.00 UUUCUU-CUUCAACAGUGUUUGGAUGGAAC
___.<<..<<<<.......>.>>>.>>.__
AY112742.1 0.00 AGUCCUGCUUCAACAGUGCUUGAACGGAAC
___.<<..<<<<.......>.>>>.>>.__
AY120878.1 0.00 GGUCGC--GUCAACAGUGUUUGAU-CGAAC
_.<<....<<<<.......>.>>>..>>._
BC001188.1 0.00 AUUAUC--GGGAACAGUGUUUCCC-AUAAU
_.<<....<<<<.......>.>>>..>>._
BC016354.1 0.00 UCUCUUGCUUCAACAGUGUUUGGACGGAAC
___.<<..<<<<.......>.>>>.>>.__
BC019840.1 0.00 UGUCUUGCUUCAACAGUGUUUGAACGGAAC
___.<<..<<<<.......>.>>>.>>.__
BC021386.1 0.00 UUUCCUGCUUCAACAGUGCUUGAACGGAAC
___.<<..<<<<.......>.>>>.>>.__
D86625.1 0.00 GUUCUUGUUUCAACAGUGAUUGAACGGAAC
___.<<..<<<<.......>.>>>.>>.__
J02723.1 0.00 GUUCUUGCUUCAACAGUAUUUGAACGGAAC
___.<<..<<<<.......>.>>>.>>.__
J02741.1 0.00 UAUCUUGCUUCAACAGUGUUUGGACGGAAC
___.<<..<<<<.......>.>>>.>>.__
J04755.1 0.00 UUUCCUGCUUCAGCAGUGCUUGGACGGAAC
___.<<..<<<<.......>.>>>.>>.__
L39879.1 0.00 GUACUUGCUUCAACAGUGUUUGAACGGAAC
___.<<..<<<<.......>.>>>.>>.__
M12120.1 0.00 GUUCUUGCUUCAACAGUGUUUGAACGGAAC
___.<<..<<<<.......>.>>>.>>.__
M16343.1 0.00 GUUCCUGCGUCAACAGUGCUUGGACGGAAC
___.<<..<<<<........>.>>>>>.__
S57280.1 0.00 UCGUUC--GUCCUCAGUGCAGGGC-AAUAG
_.<<....<<<<........>>>>..>>._
S77386.1 0.00 GUUCUUGCUUCAACAGUGAUUGAACGGAAC
___.<<..<<<<.......>.>>>.>>.__
X03744.1 0.00 UCUUGC--UUCAACAGUGUUUGGACGGAAG
_.<<....<<<<.......>.>>>.>>.__