Seq ID Score (bits) Sequence
AB073371.1 0.00 .GCGG UCUCCUGCUUCAACAGUGCUUGGACGGAGCCCGGUGCUCGCCUGCCCUUACCG
.... .............................. .......................
AC073115.5 0.00 .GGCAGCACAUUCAGCAGUCCUGUGGAUCUG UCUCUUGCUUCAACAGUGUUUGGAUGGAACAGAUCCAGGAACUCUCUUUCUUCCAGUCUCCAGCUACCUUCCAAUCUUCUCUCCAUUUUCAACCUUCGGGAACAUCUUCUCGGUCAUCUCCUGCUUCUGGGACCAGCCAACACCAUUUUUGUAGUUAGCUCCUUCUUGCUAACCAUGAGCUCCCAGAUUUAUCAGAAUUA
.............................. .............................. ..........................................................................................................................................................................
AC109352.3 0.00 .GACGCUCUUCACGUAGAGUGUCCACGG UUUCCUGUUUCAACAGUGCUUGGA-GGAACCAGGGCUUGUCCUUCACCCUGGCCUGUGGCUCACAGCCAGCCUUCCAGCACCUCCUCACCGCGCCGUGGGACCACCCCAAGGCCCCUGCCGGCUCCAGCGCUGCGCAGCCUCUGUGGCCUCGGCCUCUCCUUAGCCCCGCCAUGAGGAUCGGCGUUCUCACAGGUGCCAGAAC
........................... .............................. .............................................................................................................................................................................
AF086786.1 0.00 .U UCGUUC--GUCCUCAGUGCAGGGC-AACAGAACUUCGGGCUCAAGAGGGUGGCAGCAGCCAUGUUGCUACAGCGUUGCCCAGUGCUUAUCCGGAGCCCCACAGCCAUCCUGGGCAAGAUGAUUAAGACUCACCAGUUCCUGAUUGGUAUUGGACGCUGUCCCAUCCUGGCCACCCAAGGAACAACCUGUUCUCAAAUCCACCUUAAGGCAACCAAGGCUG
. .............................. ..............................................................................................................................................................................................
AF117958.1 0.00 .CCUCCUUGCCACCGCAGAUUGGCCGCUAGCCCUCCCCGAGCGCCCUGCCUCCGAGGGCCGGCGCACCAUAAAAGAAGCCGCCCUAGCCACGUCCCCUCGCAGUUCGGCGGUCCCGCGGGUCUG UCUCUUGUUUCAACAGUGUUUGGACGGAACAGAUCCGGGGACUCUCUUCCAGCCUCCGACCGCCCUCCGAUUUCCUCUCCGCUUGCAACCUCCGGGACCAUCUUCUC
........................................................................................................................... .............................. .............................................................................
AF171078.1 0.00 .GGGGGUGGGGUGGGGUGGGCGGGGCUGAGCAGGAGGCUGGGAUGAAAGCUGCUUCCCAGCCCAGCCCACAGCACUCACCGUCUU UGGUUC--GUCCUCAGUGCAGGGC-AACAG
.................................................................................... ..............................
AF266195.1 0.00 .AGAUCGGGAAGAG AUUCUUGCUUCAACAGUGUUUGAACGGAAUUUCUUUCUUCGUCCAAAGCUUUUUCAGUCGCUYYUMAUUUUGCGACUCAGAGGAUCCGUUUUACUUGAAACACGUACUGAAUACYGUCUGCGCAGAGCUAUAUUUUU
............. .............................. ...........................................................................................................
AF285177.1 0.00 .UU GUUCCUGCUUCAACAGUGCUUGGACGGAACCCGGCGCUCGUUCCCCUCCCCGGCCCGCCGCUCAGAGCCAGCCCUCGGCCACCCUCCACGCAGCGCUCUCGGACCGCCCCGAGGCCUCCGCCGCCGCCGCCCCAGCGCCGCGCAGCCGCCGCCGCCGC
.. .............................. ................................................................................................................................
AF338763.1 0.00 .GCACGAGAGG UUACCUGCUUCAACAGUGCUUGAACGGCAACCUUCUACUCUUUCGAAGCAAUUUUUUUUUAAAAAUGAAAUUCAU
.......... .............................. .............................................
AL034379.8 0.00 .CAUUCAUGUACAAAAAUGUUGUUGUGUAUUCUUGUUUCAAAAAGAAAAAAAUGAGACGUUCUUUGCGGAAAGUCCCUGGAG UUUCCUGGUUCAACAGUGCUUGGACGGAACCAGGCACUCGUACCCCACUCCGGCUGGCCGCCCAUAGCUAGCCCUCUGUUACCUCUUCACUGGGCCCUCUGACUGUCCCAAGGCCCCCGCCGCCACUCCAGCGCCGUGCAGCCACCGCC
................................................................................. .............................. .......................................................................................................................
AL355837.6 0.00 .GCCAUACUUGCUUCAGACCUUUUCCUCCAGAGAUGACCAGUAUCCUAAGUUGAUGUGCAUCAUUCCAACCAUUUCUGUUUUUGGAUACUUAAACCUGUAUUCCUAAGAAAUACAGAAUAUUGUUUUAUGUGUUUAAAAAUGUGCAGUGCAUUUGGU GUUCCUGCUUCAACAGUGUUUGGAUGGAACAGAUCCAGGGACUCUCUUGGGAAAAAAAAAAAGUAUGUAACCUU
............................................................................................................................................................ .............................. ............................................
AL513423.3 0.00 .CGUUGGGG UUUCCUGCUUCAACAGUGCUUGGAUGGAACCCAGCCCUCGUCCCCUACCCCGGCCAGCCGCCCAUAGCCAGCCCUCCGUCACCUCUUCACCGCGCCCUGGGACUGCCCCAAGGCCCCCGCCGCAGCUCCAGCGCCGCGCAGCAGCCGCCGCCGCCGCCUCUCCUUAGUCACUGCCAUGACGACCGCGUCCACCUCGCAGGUGCGCCAGAACUACCACCAGGA
........ .............................. ................................................................................................................................................................................................
AP003174.2 0.00 .GCCAUCUUCCAACAUUCAAAUGGAAAUCAUAUAGAAAAGGAAUCAGAUUUAAUUGAAAGGGUUUCAAAAAACAGAACUCACACCAAUAAGAGAAAUGGCAGGCAGAGUGUUCAGCAGUCCCAUGAAUAUG UUUCUU-CUUCAACAGUGUUUGGAUGGAACAGACCCGGGGACUCCCUCUCUUCCAGCCUCCGAGCAUCCUCCAGUCUCCUCUUCACUUGCAAACUCCGGG
.................................................................................................................................. .............................. ......................................................................
AY112742.1 0.00 .CAUUCGGCACG AGUCCUGCUUCAACAGUGCUUGAACGGAACCCGGCGCUCGCUCCCCGCCCCGGCCGGCCACCCAGAGUCAGCCCUCCUUCACCUCCUCACAGCGCCCUCGGCCCGCCGCAAGGCUCCCGCCGCCGCUCCAGCGCCGCCCCGCCGCCGCCGCCCUCUCCUCUCCUCAGCCGUCCGCCAUGACGACCGCGUUCCCCUCGCAGGUGCGCCAGAACUACCA
........... .............................. ...........................................................................................................................................................................................
AY120878.1 0.00 .GGAGAGAGAGAGAGAACUAGUCUCGAGUUUUUUUUUUUUGUUUUUUGGU GGUCGC--GUCAACAGUGUUUGAU-CGAACACCUGUUCGUCUUUUUAACGAUUUUUUAAGAGAG
................................................. .............................. ..................................
BC001188.1 0.00 .GUUUUUACCUACCACAGUGUCUGUAUCGGAGACAGUGAUCUCCAUAUGUUACACUAAGGGUGUAAGUA AUUAUC--GGGAACAGUGUUUCCC-AUAAUUUUCUUCAUGCAAUGACAUCUUCAAAGCUUGAAGAUCGUUAGUAUCUAACAUGUAUCCCAACUCCUAUAAUUCCCUAUCUUUUAGUUUUAGUUGCAGAAACAUUUUGUGGUCAUUAAGCAUUGGGUGGGUAA
.................................................................... .............................. ....................................................................................................................................
BC016354.1 0.00 .CCCGCGGGUCUG UCUCUUGCUUCAACAGUGUUUGGACGGAACAGAUCCGGGGACUCUCUUCCAGCCUCCGACCGCCCUCCGAUUUCCUCUCCGCUUGCAACCUCCGGGACCAUCUUCUCGGCCAUCUCCUGCUUCUGGGACCUGCCAGCACCGUUUUUGUGGUUAGCUCCUUCUUGCCAACCAACCAUGAGCUCCCAGAUUCGUCAGAAUUAUUCCACCGACGUGGAGGC
............ .............................. ............................................................................................................................................................................................
BC019840.1 0.00 .CGUGGAUCUG UGUCUUGCUUCAACAGUGUUUGAACGGAACAGACCCGGGGAUUCCCACUGUACUCGCUUCCAGCCGCCUUUACAAGUCUCUCCAGUCGCAGCCUCCGGGACCAUCUCCUCGCUGCCUUCAGCUCCUAGGACCAGUCUGCACCGUCUCUUCGCGGUUAGCUCCUACUCCGGAUCAGCCAUGACCUCUCAGAUUCGUCAGAAUUA
.......... .............................. .............................................................................................................................................................................
BC021386.1 0.00 .CCACGCGUCCGCGCCCAGAGUCGCCGCGG UUUCCUGCUUCAACAGUGCUUGAACGGAACCCGGUGCU
............................. .............................. ........
D86625.1 0.00 .GAGAA GUUCUUGUUUCAACAGUGAUUGAACGGAACUCCUCUGCCUUCGUCCCGCAUUAUAGAACAUUGAGGGUUAAUGACAUAGC
..... .............................. ..................................................
J02723.1 0.00 .AAUCUUAUACGUCCCCCAGAUCUACACCUGACUGAGUAGA GUUCUUGCUUCAACAGUAUUUGAACGGAACCCUCUCUGAGUACUUUGCUCUUUUUUCAAACCUCUUCCAAUUGCUGAUUUUCUCUGAUAUUUUUGCGCCACCCAAAACCACCGAAAUGGCAUCCCAGGUGCGUCAGAACUACCACAGCGACUGCGAGGCUGCCGUCAACCGUAUGUUGAACUUGGAGCUG
........................................ .............................. ................................................................................................................................................................
J02741.1 0.00 .UGGGAGGGGCGCGAGGUUCCCCUCAGCUCGGGAUUGGUCAGGUAUACUUUUACGUCCCCACCUCACGCCACCGCCGAUUGGUUAGUCUCGGGCCUCGGACACCCCGCCCUCCGGAGGCCAGCAUACUAUAAAAGGAGCGGUCCUCGCGCUCUUAUCUGAGCAGCGCUUUGGAGAUCCCGAGGAUCUG UAUCUUGCUUCAACAGUGUUUGGACGGAACAGACCCGGGGACU
........................................................................................................................................................................................... .............................. .............
J04755.1 0.00 .GAUAGGGUAAAAGUGGAAGAAUGACAAAAGAAGAGACAUUCUUCACCAAGAGUCCUCGGGG UUUCCUGCUUCAGCAGUGCUUGGACGGAACCCGGCACUUGUCCCCCACCCAGGCCAGCUGCCCAUAGCCAGCCCUCCGUCACGUCUUCACUGCACCCUCAGACCACCCCAAGGCCCCCACCGCCGCUCCAGCGCCACGCAGCCACCGCCGCCGCAGCCUCUCCUUAGUC
............................................................. .............................. ...........................................................................................................................................
L39879.1 0.00 .CUCCUCCGGAGGGUCAACAUGCUAUAAAAGGAGCGCUCCUUGCCCGGGAGUUAGAGCAGCGCCUUGGAGGUCCCGUGGAUCUGU GUACUUGCUUCAACAGUGUUUGAACGGAACAGACCCGGGGAUUCCCACUGUACUCGCUUCCAGCCGCCUUUACAAGUCUCUCCAGUCGCAGCCUCCGGGACCAUCUCCUCGCUGCCUUCAGCUCCUAGGACCAGUCUGCACCGUCU
.................................................................................... .............................. ....................................................................................................................
M12120.1 0.00 .UUAGUAGA GUUCUUGCUUCAACAGUGUUUGAACGGAACCCUCUCUGAGUCCUUUGCUCUUUUACUUUUGAAACAUCUAUUGCAUUACUGAUUUUUUUGCGCCACCCAAAACCACCAAACCGCUGAAAUGGAUUCCCAGGUCCGCCAGAACUUCCACCGCGACUGCGAGGCUGCCAUCAACCGUAUGGUGAACAUGGAGCUGUACGCCUCCUACACCUACCUCUCCAUGGC
........ .............................. ................................................................................................................................................................................................
M16343.1 0.00 .ACGCUGCGGCGGUAUAAAAGCGGCUGCGCGGCGCGGCUGCUCCCAGAGCGCGUCGGCGAGGCUGAGCGGAGCGG GUUCCUGCGUCAACAGUGCUUGGACGGAACCGGCCGCGCUCGGGCCCGCCGCCUCCCCCGACCGCCACCGCAGCAGCCGUCGUAUCCACCGCAUCUCUCUCUUUCUCUCCCGCCAGCGCCAUGGCUACGCCUCCUUCCCAGGUGCGCCAGAACUAC
.......................................................................... .............................. ..............................................................................................................................
S57280.1 0.00 .ACUUUGGGUUUUAUCUCUAGCAAGGAAGGGACUGAGAUACCUUUGGGGCCAAUGCAGGCCCAGGCCCGCAGAAGGCAGGGUGGGUGGGGCUGAGUCAGAGGGAGAAGGGAUAAAUGCCAGGUCCUAACCCAAGUACCCACCUGUCGU UCGUUC--GUCCUCAGUGCAGGGC-AAUAGGUA
................................................................................................................................................... .............................. ...
S77386.1 0.00 .UGGCCAAGUCGGCCAGCGCAUGAAGAA GUUCUUGCUUCAACAGUGAUUGAACGGAACUCCUCUGCCUUCGUCCCGCACUAUAGAACAUUCCGGAUUGAUAAGGUAACACUAACUUUAACUGUAAUAGCAAAAUAGUCGAAGGAACUUUAUUUUUCUACACUUUAU
........................... .............................. ............................................................................................................
X03744.1 0.00 .G UCUUGC--UUCAACAGUGUUUGGACGGAAGAGAUCCUGGGACUUCCUCUCUUCCAGCCUCUCACUAUCAAUCUCCUCUCCACUUGCAACCU
. .............................. .............................................................