Seq ID Score (bits) Sequence
AF007904.1 0.00 .CGUCACCUACACCGAGCACGCCAAGAGAAAGACCGUCACCGCCAUGGACGUGGUCUAUGCUCUGAAGCGCCAAGGCCGAACCCUCUACGGAUUCGGCGGUUAGAUUAUGUGCUUAUGAGUACAUCUAAC AAAACGGUCCUUAUCAGGACCAAACAUUUAUUCCAAAGAAUGAUUCAAUCCAAAACCUAUACAUAACUCAAGAAUAUCAGCUUGUGUCUUAGGGUCC
.............................<................................................................................................... .....<...>>............... .......................................................................
AY028698.1 0.00 .UCAAAAC CCAACGGUCCUUAUCAGGACCACUAUAUAUUUUAUUGAUAUUUUUUUCUCUAUGAAGUUGUUUUACAAAUAGAAAUUAAUGUAAGAAUGAAUUGAAAAAAAAAAAA
....... .......................... ............................<...>...............................................
AY064471.1 0.00 .ACCGAGCACGCUAAGUGCAAGACCGUCACAGCUAUGGAUGUUGUCUAUGCUCUCAAACGUCAAGGCCGCACUCUCUACGGCUUCGGCGGAUAAGUGCACCCAACCCAAACGUUCAGAACAACC AAACCGGCCCUUUUAAGGGCCACAACCAAUUCCCAAUGGCACUGUCAAAACAGUAAUUGUGUUAUGAGUUGCCCAUACUUCCCAUAGUCCGUGCUCACGCUUG
...................<....................................................................................................... .....<...>>............... .............................................................................
BC016336.1 0.00 .CCCGCGGAGUGUUGAAGGUGUUCCUGGAGAACGUGAUCCGGGACGCCGUGACCUACACGGAGCACGCCAAGCGCAAGACGGUCACCGCCAUGGACGUGGUCUACGCGCUCAAGCGCCAGGGCCGCACCCUCUAUGGCUUCGGCGGCUAAAUGGCAUUUUGAAGCCCAGUCAUUCUCU AAAAAGGCCCUUUUUAGGGCCCCUAAGCUUUCAACAAAAGAGUUGAAAU
...........................................................................<..................................................................................................... .....<...>>............... .......................
BC020884.1 0.00 .GUCCCCACAGCUUCUCUACAGACUC CAAAAGGCCCUUUUCAGGGCCCCCAAACUGUCACAGAAAGAGCUGUUAACACUUCCUAGAUAACGGACCAAGUCUAGCUCUGCCACCGAGGCUGGAGUGCAGUGGCACGAUCUCGCCUCCGCCUCCCGGGUUCAAGCGAUUCACCUGCCUCAGCUUCCCGAGUAGCUGGGAUUACAGGCCUGCGCCACCACGCCUGGCUAA
......................... ................<......... ....................................................................................................>..........................................................................
J00985.1 0.00 .UCCUCUUUUCCUAUC ACAACGGCCCUUUUAAGGGCCACAAAAAAAAAAAAAA
............... .......................... ...........
J00986.1 0.00 .GAGCACGCCAAGAGGAAGACCGUCACCGCUAUGGAUGUGGUGUAUGCUCUGAAGCGCCAAGGACGCACUCUGUACGGAUUCGGAGGUUAAAGGCUCGCUUCUGUUUCCUCAUC AAAACGGCCCUUUUAAGGGCCACCAAAAAAAAAAAAAAAAAAAA
................<................................................................................................ .....<...>>............... ..................
J00987.1 0.00 .GCUGUCACCUACACCGAGCACGCCAAGAGGAAGACCGUUACCGCCAUGGAUGUGGUGUACGCUCUCAAGCGCCAGGGCCGCACUCUCUACGGCUUCGGCGGAUAAAUCUCUUCCUUCCCACUAAUCUUAUA CCCAAGGCUCUUUUCAGAGCCCCCCACGCUCUCACUCCUAGAGCUGUUACUGCUUUUUUUACAUAUUUAU
...............................<................................................................................................... .....<...>>............... ............................................
L19706.1 0.00 .GCGCUUCCAGAGCUCGGCCGUCAUGGCGCUGCAGGAGGCCUGUGAGGCCUACCUUGUGGGUCUGUUUGAGGACACCAACCUAUGCGCCAUCCACGCCAAGCGUGUGACCAUCAUGCCCAAGGACAUCCAGCUGGCCCGCCGCAUUCGUGGCGAGAGGGCUUGAGGAGUUCUGUGAUCCACGCAACCACUU UAAAAGGCUCUUUUUAGAGCCACUAAUCUUCCAAAG
..................................................................................................<........................................................................................... .....<...>>............... ..........
L19778.1 0.00 .GAGAGCCACCACAAGGCGAAGGGCAAGUAACUAUCUGUACUAGUUUGUGGCAGCUCAAGUAAAAUCGAGUCCAAA CCAACGGCUCUUUUCAGGGCCACCCACGUCUUCUCUAAAAGAACUUAACAUUUAUUCCAUGUGAAAGAAAGUGAGACAUGGACAAGACUCUAGUCAUAAAUUACCCAUCUUUUUGAAAACAGUGUAGCGAACACCGCAGAUUUAAAAGAAA
.........................................................<................. .......................... ...........................................................<...>>............................................................
M10557.1 0.00 .CACUACCUCCAAGUAGACAGGUCAUAUCCUGCUCUAAUUGGACAU ACAACGGCCCUUUUCAGGGCCACACAAAUAAUCAAGAAAGAAUGAUAUCCGUAAUA
............................................. .....<...>................ ..............................
M60746.1 0.00 .CUAAAGACAUCCAGCUUGCCCGCCGCAUUCGUGGGGAGAGGGCGUGAAUUGUUUUGAGUACAAACCUUAAAU CCAAAGGCUCUUCUCAGAGCCAACCACUUUGUCCGUGAAAAGGGCUGUAAUCCUUUGAGACGCAUUAGACCACUAAACUGCACUGAUCCAAAUAGACAUUUGAAAUAGUGGCAUUCAGUUCCCUCGAUGCUUCAUUUAAAUUUCCAAAUUUAAG
........................................................................ .....<...>................ ................................................................................................................................
M60747.1 0.00 .GCGGGACGUUCCCCUUUGAAAAUUU UAAACGGCUCUUUUCAGAGCCACCCACAGGUCUCAGUCAAAAGAGCUGAAGCUUUUUGGAGGGGGGAGUGGGGUGGAGAGGGGUGCUGCGGUGUUGUGCGGCCACGGUCUAUCCUAGUCGUGCUGGUUGGGGGUCAGUUAUUAACAGCUCCCAGCAGCCUGGGCGCAAGGAUCC
......................... .......................... .......................................................................................................<...>........................................
S49118.1 0.00 .AAGGUGAAGAAGACCUCGCCCAAGAAAAAGGCUGCACCCAAGAAGAAGUAAAGCCUUUUCCUGACUAUUCAUUCUAGCAUCUGUCUGGACUGUUACGC ACCCCGGCUCUUUUCAGAGCCAAAACAUAUGUUUCAACAGAUAUACAUACCAAGCUCUCUCAAACUCAUUUACAGUCAGCAUUAGAAUGAUUGUACUUCUGAUCACAUCUUUUGUGUCAGGUAGUAGG
.................................................................................................. .....<...>>............... ......................................................................................................
U37575.1 0.00 .UCGACCAUCACGUCGCGGGAGAUCCAGACGGCCGUGCGGCUGCUGCUGCCCGGCGAGCUGGCCAAGCACGCGGUCUCCGAGGGCACCAAGGCGGUCACCAAGUACACCAGCUCAAAAUAAGAAGGUUCUAAACUAUAACC CAAACGGCUCUUUUCAGAGCCCCCAACUUUUCUUACAAAGGGCUGUAAUUGCUUUUUUUUUCCCCCCUCAUAUAUAAGAAAAAUUG
....................................................<....................................................................................... .....<...>>............... ............................................................
U37576.1 0.00 .CGCCGUCACCUACACCGAGCACGCCAAGAGGAAGACGGUCACGGCCAUGGACGUGGUCUACGCGCUCAAGCGCCAGGAACGCACCCUCUACGGCUUCGGCGGUUAAACUCGCCUUCGAUAACAGCUCGUUUUUAGCAAC CCAAAGGCUCUUCUCAGAGCCACCCACUUAAAUUGGAAAAGAGCUGUGUCGCUUCAACCUAGUUAAGUCUUAAUUCUAGCACCAGUA
................................<.......................................................................................................... .....<...>>............... .............................................................
U62673.1 0.00 .AACAAGUUACUAGGGGGAGUCACCAUCGCCCAGGGCGGGGUCCUCCCCAAUAUUCAGGCUGUCUUACUUCCGAAGAAAACGGAAAGUCAUAAGCCUGGAAAGAACAAAUAACUAUUAUCCCUUUCCACAC AAAAAGGCUCUUUUAAGAGCCACCAAAGUGUCAUCCAAAGGGCUGGUCACAAACUGGCGCGUUAGCUAGCUCCUUUGUAAAAGAUUUGGUGGCUCU
..................................<............................................................................................... .....<...>>............... ......................................................................
V01357.1 0.00 .ACGAUCGCUCAAGGUGGUGUUCUGCCCAACAUCCAAGCCGUGCUGCUCCCCAAGAAAACCGCUAAAUCAAGCUAGAUAGAGUUUGCUCCCGGCAAUCUUGAAACC UCAACGGCCCUUAUCAGGGCCACCAAUUACUCACGAAAGAAUUGUUUCAUUUAUGAAUUCCCUUCCCCCACUCUCUCUCUCUCUCUCUCUCUCUCUCUCUCUCUCUCUCUCUCUCUCUCUC
.............<........................................................................................... ......................>... ...............................................................................................
X00224.1 0.00 .GAGAAUGUCAUCCGGGACGCUGUCACCUACACCGAGCACGCCAAGAGGAAGACCGUUACCGCCAUGGAUGUGGUGUACGCUCUCAAGCGCCAGGGCCGCACUCUCUACGGCUUCGGCGGAUAAAUCUCUUCCUUCCCACUAAUCUUAUAC CCAAAGGCUCUUUUCAGAGCCCCCCACACUCUCACUCCUAGAGCUGUUACUGCUUUUUUUACAUAUUUA
.................................................<.................................................................................................... .....<...>>............... ...........................................
X01685.1 0.00 .UGAGGACACCAACCUGUGCGCCAUCCACGCCAAGCGUGUCACCAUCAUGCCCAAGGACAUCCAGCUGGCCCGCCGUAUCCGCGGCGAGCGGGCUUAAUAGGCACGCUUUCUACACUGGCACGUAAACC AAAACGGCUCUUUUAAGAGCCACCUCCAUUAUCCACCAAAGAUGCUUGAAGUACAAGUUGUGAGAGUUUUCUAGGGUUUCCUAUUAUAGCCUUUCUUG
................................<............................................................................................... .....<...>>............... ........................................................................
X01752.1 0.00 .GCCAAGGCUGGCCGCCCCAAGAAGGCCGCCAAGAGCCCGGCCAAGGCAAAGGCGGUGAAGCCCAAGGCUGCCAAGCCCAAGGCGACCAAACCCAAGGCGGCCAAGGCGAAGAAGACGGCAGCCAAGAAGAAGUAAGUUAUCCCAGAAGAGUCCUGCUCUACCUAUUUUGAUAU CCAACGGCUCUUUUAAGAGCCACCCACACUUUCCCUAAAGGAGCUGAGGCACC
..............................................................................<.............................................................................................. .....<...>>............... ...........................
X02622.1 0.00 .AAAA CCCAAGGCUCUUUUCAGAGCCACCACUUCUUCAUAUAAGAG
.... .......................... ...............
X02624.1 0.00 .UACCAAGGCAGCGAAGCCCAAAGCCGCCAAGCCCAAGGCGGCCAAGGCCAAGAAGGCAGCCCCCAAGAAGAAGUAAACCUAUUACAAACAGUGUUCUUUCUACUCGACACAUGUUGUUACCA CAAAAGGCUCUUUUAAGAGCCACCCACCUCUUUCCAUAAAAGCGCAUGUCAUUCCAUUCCACCUACCUACCCGUGGUGCAAAAGAAAUGAAAUGAAUGACUUUU
...................<...................................................................................................... .....<...>>............... ..............................................................................
X02916.1 0.00 .UUCGAGCGUAUCGCCGGAGAGUCGUCUCGCUUGGCCCACUACAACAAGCGUUCCACCAUCACCUCUAGGGAGAUCCAGACCGCAGUGCGCCUGCUGCUCCCCGGAGAGCUGGCCAAGCACGCAGUGUCCGAGGGCACCAAGGCCGUGACCAAGUACACCAGCUCCAAGUAAACAGCCCAUUUGGAGUGCUGUAGUAA CCCAAGGCUCUUUUAAGAGCCACCCAACC
.......................................................................................................<............................................................................................. .....<...>>............... ...
X03017.1 0.00 .CCAACAAC ACAAAGGCUCUUUUAAGAGCCCCCACAUCUUAUUUUAGGAAGAUCUGUAACUUCUCUGAGGCGUGCUAAUGAAAAGUAAUAUUUUAGGGCUUCAUAUUCUAUAGUGUGUCUGUCUCUUCUCGGACUUUACAAGAAAAUGCUUUUGGCGUUCGUGACAUCCCUAACUUUCUAUAAAUACUUGAGCUUUAACCUCGCUGUGUGAGUCCCUGGUUCUACAG
........ .......................... ...............................<......................................................................................................>.........................................................
X03018.1 0.00 .CCAAUUCA ACCAAGGCUCUUUUAAGAGCCACCACACCCCCCUGAAAGAGCUUACAACUUCCCGCGUCUCCUGCUUCUACCACAAGUCUCCCUACAUACCGUAAUAUUUUCUCACUAACACCACUACAAGUUCCCACAUGUAGUCGUUUAGUGGUGCCGGCCGCCGCGAGUACCAACUCGGCUUAAACAUUCUAUUCGGAGGGAGGAGGGCGGAGAGAGUUAAUGGA
........ .......................... ................................................................................................................................................................................................
X03952.1 0.00 .ACAUCUAAAUAAA CCAACGGCUCUUUUUAGAGCCACCACAUUUCCAAGAAAGAUCAAAUUCUAAACUCUGCGUAGAUC
............. .......................... .......................................
X04384.1 0.00 .CACCAUCUCCAGCCGGGAGAUCCAGACUGCUGUUCGUCUACUUCUCCCAGGAGAACUGGCCAAGCAUGCUGUAUCCGAGGGAACGAAGGCUGUGACCAAAUAUACCACCUCCCGCUAAAUUUCACCAGCUUUCGUUUAGCUGGAAAAUAAC CAAACGGCUCUUAUCAGAGCCACCAAAUUUUCAAGAAAGAAUCGAAAAUACAUCUCUUUUUGCCCAACACGUAGC
..................................................<.................................................................................................... .....<...>>............... .................................................
X04488.1 0.00 .CCAAGCCAGCAAAGAAGGCAGCCAAGAAGCCCGCCGCCAAGAAGGCAGCCAAGAAGUAAAUUCUUAGCGCCACUUGGUGUAUUGAGCUUUUUCAGCUCCACC CCAACGGCUCUUAUCAGAGCCACCCAAACUUCAAGAAAGAAUUC
..............<....................................................................................... .....<...>>............... ..................
X05620.1 0.00 .AAGGCGGUCACCAAGUACACGACUUCAAAAUAAGCUGGCCCGAGGUCAUGCAUAAUC CAAACGGCUCUUUUCAGAGCCAACACAUUUCCCAAAGAGAGAUUUAAACAUG
......................................................... .....<...>................ ..........................
X05862.1 0.00 .GAAGUGAAACCAAACAUUACGAAUC ACCAAGGCUCUUUUCAGAGCCACUCACUUUCUCAAAGAGACCUAACACUACUGGGAUAGUGCAUUGUGGGAAAUACGUGUAUUAACCUUCCUCCUAUUUUCCCUGCUUGUGGUUAGUUCAACCCCUAAGCCUUAGGCUAAGAGUAUAUUGGUUUUUGGAAGGCAGGCACCCAACCUCGGACCUAGUACAUAAAACAGACAC
......................... ................<......... .....................................................................................................<...>>....................................................................
X06639.1 0.00 .CCUUGAGAACGUCAUCCGUGAUGCCGUCACCUACUGCGAGCACGCCAAGAGGAAGACCGUCACCGCCAUGGACGUCGUCUACGCCCUGAAGCGACAGGGACGUACCCUCUACGGAUUCGGAGGUUAAGAAGUUACUCUCUUCCAACCCAUCAAC AAACCGGCUCUUUUAAGAGCCACCAAAUAACCAAGAAAGAAUACAGUAGAUAUCUUUGUACGUUUUUUUUUU
.....................................................<.................................................................................................... .....<...>>............... ..............................................
X06641.1 0.00 .AUGGACGUCGUCUACGCCCUGAAGCGACAGGGACGUACCCUCUACGGAUUCGGAGGAUAAGAAGUGACUUUCUUACAAGCAACAA ACAACGGCUCUUUUUAGAGCCACCAAAUAUUCAAGAAAGAAAUAUUAGAUAAACUUGUUUAAGUCUUAUUAAUAUUGAUACAUGUAAUGAAAUAUGAAAUUUAAUAUCAGUAAAUAAUUAAUUGGAAUUAGCCGAGUC
..................................................................................... .......................... .........................<...>..................................................................................
X06642.1 0.00 .GAACAAGCUGCUCAGUGGAGUCACCAUCGCCCAAGGUGGUGUCCUCCCCAACAUCCAGGCCGUACUUCUGCCCAAGAAGACCUCCAAGGCCUCCAAGUAAACGGGCCNNNNNNCCUCUUCGGAGCAAUCCA ACAACGGCUCUUUUAAGAGCCACCAAAUUUCCAAGAAAGAAACAGCAGAUGCACUCUAAUUAUGUUUAAAUAUUUUAAUGGUACUUUAAGUUACU
...................................<............................................................................................... .....<...>>............... .....................................................................
X07772.1 0.00 .UAGACAGAAAUCCAAGCAUCAACC AAAACGGCUCUAUUCAGAGCCACCACAAUUUCACAAAAGAGAUCAAUUCCUAUCAAGUACCGUUUGCUCCUACGAACUGGACUCAUUAUUACAAACUCAAACACUUUUUUUACAAACUCAAACACUUUUUUUACAAACUCAAACACUUUUUU
........................ ................<......... ......................................................................................................<...>>..................
X13236.1 0.00 .CACGGAGCACGCCAAGCGCAAGACCGUCACCGCCAUGGACGUGGUCUACCGGCUCAARCGCCAGGGCCGCACCCUCUACGGAUUCGGGGGUUAAGGGACUAGAGCGAUUUUCUUAACUGUUA CAAAAGGUCCUUUUCAGGACCACUCACUGAAUUCCUUAAAAAGCUGUGCAUUUUGCUCCCUCACCCUUCCCCCACACUGGCAGCCGCCCUCACUAAUAGCUUCA
....................<..................................................................................................... .....<...>>............... ..............................................................................
X13554.1 0.00 .CCUUGGCCCCCUCCCCCACUC ACAAAGGCCCUUUUCAGGGCCCCCAAACUAUCCAAAAGGAGCUGUGGACAUUUAGUCUCUAGGUUAGGAUUUAUGAACACCCAAUCCUUAGCAUUCGGCUUAGCAUUGUCUCGUAUGCAAACUAAGCUU
..................... .......................... ............................<...>......................................................................
X14215.1 0.00 .CCAAACGGCUGUUCGCCUGCUUUUGCCUGGAGAGUUGGCCAAGCAUGCUGUCAGUGAGGGAACCAAGGCUGUCACCAAGUACACCAGCUCUAAAUAAUUUUCUCCUGCGAAUGCGGACAAUAAUCC AAAACGGCCCUUUUCAGGGCCACAAUGUGUUAUACCAAAGAAAUGCAUUUUUCAACCACCAAUCAUCGAAUAUGAAUUUACAAAUAAAACUUAUUUACCC
.............................<................................................................................................ .....<...>>............... ..........................................................................
X14730.1 0.00 .AGACGCGCAUCAUCCCCCGCCACCUGCAGCUGGCCAUCCGCAACGACGAGGAGCUCAACAAGCUGCUGGGCAAGGUCACCAUCGCGCAGGGCGGGGUGCUGCCCAACAUCCAGGCCGUGCUGCUGCCCAAGAAAACCGACAGCCACAAGGCUAAAAGCAAGUAAAAACCCGGGGACUGUUCCCACCUCAAGCAAC ACAAAGGCUCUUUUUAGAGCCACCCACUUCC
..........................................................................................<........................................................................................................ .....<...>>............... .....
X15634.1 0.00 .UCUAACCGAAC CCAACGGCCCUCUUUAGGGCCACAAAUGUAAUAUAAUCCGGCUUGAUUUCUAAUAAAUUUGUAUUGUU
........... .......................... .............................<...>........
X16496.1 0.00 .CCCAAGGACAUCCAGCUUGCUCGCCGCAUUCGUGGGGAGAGGGCGUAAAUUGUCUUGUGAAUGUGUGCUAACCAAAAC CCAAAGGCUCUUUUCAGAGCCAACCACCUUUUCUAUAAAAAGUUGCGU
.............................................................................. .....<...>................ ......................
X17072.1 0.00 .CUCUCGUUUGGCCCACUACAACAAACGUUCUACGAUUACCAGUCGGGAAAUCCAAACUGCAGUCCGUCUUCUGUUGCCCGGAGAGUUGGCCAAGCACGCUGUCAGUGAAGGAACAAAGGCAGUUACCAAGUACACUAGCUCCAAGUAAAUCUUAGCUUGAUGUAUGCAGAACACCCAAAAG CAAAAGGCCCUUUUCAGGGCCACAAAUCUUUUUUCAAAGAAUAUG
................................................................................<.................................................................................................... .....<...>>............... ...................
X57128.1 0.00 .CUAUUCACGCUAAACGCGUCACCAUCAUGCCCAAAGAUAUCCAGCUGGCACGUCGCAUCCGUGGGGAAAGGGCAUAAGUCUGCCCGUUUCUUCCUCAUU GAAAAGGCUCUUUUCAGAGCCACUCACAAUUUCACUUAAAAACAGUUGUAACCCAUUCGGUUGUCUAUGUUAGUUUCCAGGAGAUAUAAACGUGAUAACUACACACAAGUUUUGUAACUGCAGACAA
............<...................................................................................... .....<...>>............... .....................................................................................................
X57130.1 0.00 .UAGUAACC CAAACGGCUCUUUUAAGAGCCACCUACGCAUUUCAGGAAAAGAGCUGUAGUACACAGAUGAAAUCCCCCAAGCAAAUGCAACACGCCCUCAAUUAUAUUAGAAUCACUUGGAGAGUCGAUAGAACUUUAACAUAGCCUCAUCUAGUAAGAAUUUACUACUCAAUCUAUCAAAGAUAGCAAGGAUUGAAUUC
........ .......................... .....................................................................................................................................................................
X58895.1 0.00 .CCAUCCACGCCAAGCGUGUCACCAUCAUGCCCAAGGACAUCCAGCUGGCCAGACGUAUCCGUGGCGAGCGUGCUUAAACAGCAGCGACCCACAUAGCUGUACCUCUU CACACGGCUCUUUUUAGAGCCACAUACUUCUUUUUAGAAGAUGCUUAACGUGCUUGUCGAGAUAGCAGUUGACUGUAAUAGUUGCACUUUAUUAGCACAUAAACAAAGCAUUAUGCCCU
............<.............................................................................................. .....<...>>............... .............................................................................................
X60482.1 0.00 .CGGAGUGCUGAAAGUUUUCCUGGAAAAUGUAAUCCGCGAUGCUGUCACCUACACGGAACACGCCAAACGCAAGACAGUCACAGCCAUGGACGUGGUGUACGCGCUCAAGCGCCAGGGACGCACUCUUUAUGGCUUCGGCGGCUGAGCUUACCUCUACAGUACACUACCGCAAAA CCAACGGCCCUUUUCAGGGCCACCUAUCCACUCAGGAGAAAGAGUAGUAGUC
.......................................................................<...................................................................................................... .....<...>>............... ..........................
X60483.1 0.00 .GGCCGCACCCUCUACGGUUUCGGUGGUUGAGCGUCCCUUUCUAUCAA CAAAAGGCCCUUUUUAGGGCCCCCACUUUCUCAGCUGAGGAGCCGUGAUGCUUGUUUGCCCAGUUUCUCUUUACCAUUUGUUCGCGCCUCCUGAGUUUGUGCUGCUAUCGGAGCAUGCGUCUCUAGUCGCUGUAAGUAGGCAUCAGUCACUAAUCGCUCUCCAGUAAAUAAAAUACCCA
...............................<............... .......................... ...................................................................<...>>................................................................................
X60484.1 0.00 .CCAGGGCCGCACCCUCUACGGUUUCGGUGGUUGAGCGUCCUUUUCUACCAA UAAAAGGCCCUUUUCAGGGCCACCCUACUUUCUCAGCUGAAGAGUGGUAACACUGAGGAGUGGUUUUGGUAGGUACGGAAUUUUGCUUGGUUCUGAGUCAGUUCUGGGGGGAACAGUUUUUUGAACACAGCGGCACACGUGUGGCCAUUCACCCGGGGUCACUGUAGGCAGGACU
...................................<............... .......................... ..........................................................................>..........................................................................
X71389.1 0.00 .AAGUAACUGCUCCUUGUCCUGCUCUACUCCCAGCAAC ACAAAGGCUCUUCUAAGAGCCCCCAUGUUCUCUCUACAAGAACUGCAACUCCCUGUAAG
..................................... .......................... .............<...>...............
X71390.1 0.00 .CUGCCUGGGGAGUUGGCUAAACACGCCGUGUCCGAGGGCACCAAGGCUGUGACCAAAUACACCAGCGCCAAGUAAUUGUUCCUUGUCCUGCUCUACUCCCAGCAAC ACAAAGGCUCUUCUAAGAGUCCCCAUGUUUUUUCUAUAAGAAUGGCAAUUCCCCGCAAG
.....................................................<.................................................... .......................... ..................>..............
X72803.1 0.00 .GUU UAAAAGGUCCUUUUCAGGACCACAAAAAUUAUUUUAAUUGAAGAAAAGUUUUUGAUUUUUUUGGUAUUUUAAUUUAUUUAAUAUAUUUUUGUGUACACUCAAGAUACACAAGAUGCUCAGAUUGCAUCUCUAAAAUCCAUUUCAAGGCCCAUUAAAGUCACACCCUAUCCAAAGAUCUUCUUCCAAAAUCCAGGCUUUACAGUUGUUGUAUCUUCUGAAGCAU
... .......................... .....................................................................................................................................................................................................
X72929.1 0.00 .GGGGAAGAAGGCUGCGGCUAAAAAGUAACUUGGUUCGGUGUCCCUGACUAUCCCCGGCCCAACC UCAAAGGCUCUUUUCAGAGCCACCACCAACUCCGUCAGAAGAGCCGAUACUGUGACUGCUCAUUAUGUCAGGGAGGCUUUCUGGUAUCUGCUGAAUUGUGCGAUGCCCAGUCUGAUCUUUCAGCCCCAUCUCCCCUUAACUGCGUCUCCCACACAAGUCACU
................................................................ .......................... ........................................................................................................................................
X72950.1 0.00 .GCCCGCAGGAUCCGAGGCGAGAGGGCUUAGAUACAGCUGCCACUUCUCAUACGACAAC ACAAAGGUUCUUUUCAGAGCCACUAAAUCCCAAUUACUUGAGCUGAACGCCAGUUAUUUCCUUUUUAUUCAGGGCGGGAAUCCGGAGAGAUCUUUGUCUGAUAAAAACUAUAUCGGUUCUACACAACAGGGAGUAAUGGGCACGUGACUCUUUACUCUGGUACCGAUG
.......................................................... .....<...>................ ..............................................................................................................................................
X80330.1 0.00 .AAGGGCAAGUGAGGCGGCUGCUGGCACCGGCCCGCGUCUCUACGAACCCUUCCCCCCCCCCCAGAGAACUCUCAA AAAACGGCUCUUUUCAGAGCCACCCACAGAAUCAGAUAAAGAGUUGUGUCACGGUAACCCGUCUCUUGGCCUUUCCCGGCCCUUCCCCAACAGUAAGAAUGUCGUGUGCCCUACUCUUCCCCUGGGUCCCUCUGGUAGUGCCUGUUGCUGU
.......................<................................................... .......................... ..................................<...>>.....................................................................................
X83548.1 0.00 .ACGCAAGACAGUCACAGCCAUGGACGUGGUUUACGCGCUCAAGCGCCAGGGCCGCACCCUGUAUGGCUUUGGCGGCUGAGUGUUUUACUUACUUACACGGUUCC UCAAAGGCCCUUCUCAGGGCCACCCAUGAAGUCUGUGAAAGAGCUGUAGACUAAAGAUAGUUAAUUUCUUAAGAACACUUAAACGUAUGGCAGUUUUGGCAAAUUAGCGAUUCCACAUAAGC
.....<.................................................................................................. .....<...>>............... ................................................................................................
X83550.1 0.00 .GAGGCUUGCGAGGCCUACCUGGUGGGGCUAUUUGAGGAUACCAACCUGUGCGCCAUUCACGCCAAACGCGUCACUAUUAUGCCUAAAGACAUCCAGCUUGCGCGCCGCAUCCGAGGGGAGAGGGCAUAAAUAUUCCUAUCAGCCCAAGAAGUCUGUCCAACCC CAAAAGGCUCUUUUCAGAGCCCCUCAAUUGUCACCAAAAGGAAGCUGUAGCUUUUGAGACGUG
................................................................<.................................................................................................. .....<...>>............... .....................................
Y12290.1 0.00 .GGCAGCGCCCAAGAAAAAGUGAACAGUUGGAGGCUUCUUCUAUAAC CCAACGGCUCUUUUCAGAGCCACCAACAUAACUCAAAGAGCCUGACACUUGUUUCACACUAUAACAACUGCAUUUGGGUACAAGCCUGGUGGGAUUUAGGCAUUAUUAAUUUCCCCCAGUAAACUGACAAUUUGGGUCAGUCUAGUUUCUAGUUUUAUUUCCCUGAGAUUCUGGGAAAAC
...............................<.............. .......................... ............................................................................>.............................................................................
Y12291.1 0.00 .AAGCCGUAAAGCCAAAGGCUGCCAAGCCCAAGGUUGCCAAGGCCAAGAAGGUUGCAGCCAAGAAAAAGUAGGCUGCCUCCCCUAACAAUC CAAAAGGCUCUUUUCAGAGCCACCACUCCCACUUAAGAGCUGUGACAUUUGUGUGAUUAAUGAAGCAAGGUUGCAAGGGACUCGAUCCCGGCAGCACUCGCUCCCCCGGUGGGAUGGGUGGGGUUGCGUGUCCCAC
............................................<............................................. .......................... ........................................<...>>................................................................
Z30940.1 0.00 .CAAGUGAGGCCACUGCUCGCGUCGGCCCGCGUCUCUGUGAUAUAACCCCCGCGAGCUCCC AAAAAGGCUCUUUUCAGAGCCACCCACUGAAUCAGAUAAAGAGUUGUGUCACGGU
............................................................ .......................... .............................
Z35401.1 0.00 .CGAGGCCGCCCAGCCCUCCCCACACCUCC ACAAAGGCCCUUUUAAGGGCCACCACCUCCCUCACAGAAAGAGCUGAGCCACUUCGGGCUGCGGCGGCUUGCCGCGUCCCCAUCCUUUCUCUUUCCCUCCUCUCCCCUCCCCGCCCUCGCGCCACUCUUCCCCUUACCCCGCACGGCCUCCGGUUCUGCCACGGAGGACGCGGGCGCCGCGGCACCUGCCCAUCCCG
............<................ .......................... ........................................................................>..................................................................................................
Z38128.1 0.00 .GGCUCCCAAGGCUAAGGCUUCCAAGCCUAAAGCUUCUAAGCCGAAGGCCACCAAGGCAAAGAAGGCUGCCCCUCGCAAGAAGUAGAGUGGUGCGUCCUGCUUUGAAAAUCU CAAACGGCUCUUUUCAGAGCCACCCACAACCUCAUUCAAAAGAGCUGAGCCUUUUUCUGGUUUUCUCAUGGUAUGUCCGCUGACUCUGGCUAUGUGUUCCGAAGCAGAUCAAUUC
...........................................<................................................................... .......................... ...............<..>>.....................................................................
Z46261.1 0.00 .CAA GCAAAGGCUCUUUUCAGAGCCACCACCUUUUCAAGUAAAGUAGCUGUAAGAAACCAAUUUAAGACAAAAGGGAAUGCAUUGGGAGCACUUUUCGUUUUAAUGCUACUGAAGGCUUCAAAACCAAUCGAUUUCGGCCGGUCGCGGAGACUCACGCCUGUAAUUCAAGCACUUUAAGAGGCUGAGGCGGGCGGAUUACCAGAAAUCAGGAGUUCGGGAUCAGCCU
... .......................... .........<.............................................................................................................<...>>........................................................................
Z49861.1 0.00 .GAGGCGUGCGAGUCUUACCUGGUGGGGCUGUUUGAGGACACCAACCUGUGUGUCAUCCAUGCCAAACGGGUCACCAUCAUGCCUAAGGACAUCCAGCUGGCACGCCGUAUCCGCGGGGAGCGGGCCUAGGAGGGCUAUCUCGCCACCUGAGAGGUUGCGCAACGUUCACC CCAAAGGCUCUUUUAAGAGCCACCCACCUGGUCGAAGAGUUGCUGUAGCAAGCUAG
................................................................<......................................................................................................... .....<...>>............... ..............................