Seq ID Score (bits) Sequence
AF007904.1 0.00 AAAACGGUCCUUAUCAGGACCAAACA
.....<<<<<<....>>>>>>.....
AY028698.1 0.00 CCAACGGUCCUUAUCAGGACCACUAU
.....<<<<<<....>>>>>>.....
AY064471.1 0.00 AAACCGGCCCUUUUAAGGGCCACAAC
.....<<<<<<....>>>>>>.....
BC016336.1 0.00 AAAAAGGCCCUUUUUAGGGCCCCUAA
.....<<<<<<....>>>>>>.....
BC020884.1 0.00 CAAAAGGCCCUUUUCAGGGCCCCCAA
.....<<<<<<....>>>>>>.....
J00985.1 0.00 ACAACGGCCCUUUUAAGGGCCACAAA
.....<<<<<<....>>>>>>.....
J00986.1 0.00 AAAACGGCCCUUUUAAGGGCCACCAA
.....<<<<<<....>>>>>>.....
J00987.1 0.00 CCCAAGGCUCUUUUCAGAGCCCCCCA
.....<<<<<<....>>>>>>.....
L19706.1 0.00 UAAAAGGCUCUUUUUAGAGCCACUAA
.....<<<<<<....>>>>>>.....
L19778.1 0.00 CCAACGGCUCUUUUCAGGGCCACCCA
.....<<<<<<....>>>>>>.....
M10557.1 0.00 ACAACGGCCCUUUUCAGGGCCACACA
.....<<<<<<....>>>>>>.....
M60746.1 0.00 CCAAAGGCUCUUCUCAGAGCCAACCA
.....<<<<<<....>>>>>>.....
M60747.1 0.00 UAAACGGCUCUUUUCAGAGCCACCCA
.....<<<<<<....>>>>>>.....
S49118.1 0.00 ACCCCGGCUCUUUUCAGAGCCAAAAC
.....<<<<<<....>>>>>>.....
U37575.1 0.00 CAAACGGCUCUUUUCAGAGCCCCCAA
.....<<<<<<....>>>>>>.....
U37576.1 0.00 CCAAAGGCUCUUCUCAGAGCCACCCA
.....<<<<<<....>>>>>>.....
U62673.1 0.00 AAAAAGGCUCUUUUAAGAGCCACCAA
.....<<<<<<....>>>>>>.....
V01357.1 0.00 UCAACGGCCCUUAUCAGGGCCACCAA
.....<<<<<<....>>>>>>.....
X00224.1 0.00 CCAAAGGCUCUUUUCAGAGCCCCCCA
.....<<<<<<....>>>>>>.....
X01685.1 0.00 AAAACGGCUCUUUUAAGAGCCACCUC
.....<<<<<<....>>>>>>.....
X01752.1 0.00 CCAACGGCUCUUUUAAGAGCCACCCA
.....<<<<<<....>>>>>>.....
X02622.1 0.00 CCCAAGGCUCUUUUCAGAGCCACCAC
.....<<<<<<....>>>>>>.....
X02624.1 0.00 CAAAAGGCUCUUUUAAGAGCCACCCA
.....<<<<<<....>>>>>>.....
X02916.1 0.00 CCCAAGGCUCUUUUAAGAGCCACCCA
.....<<<<<<....>>>>>>.....
X03017.1 0.00 ACAAAGGCUCUUUUAAGAGCCCCCAC
.....<<<<<<....>>>>>>.....
X03018.1 0.00 ACCAAGGCUCUUUUAAGAGCCACCAC
.....<<<<<<....>>>>>>.....
X03952.1 0.00 CCAACGGCUCUUUUUAGAGCCACCAC
.....<<<<<<....>>>>>>.....
X04384.1 0.00 CAAACGGCUCUUAUCAGAGCCACCAA
.....<<<<<<....>>>>>>.....
X04488.1 0.00 CCAACGGCUCUUAUCAGAGCCACCCA
.....<<<<<<....>>>>>>.....
X05620.1 0.00 CAAACGGCUCUUUUCAGAGCCAACAC
.....<<<<<<....>>>>>>.....
X05862.1 0.00 ACCAAGGCUCUUUUCAGAGCCACUCA
.....<<<<<<....>>>>>>.....
X06639.1 0.00 AAACCGGCUCUUUUAAGAGCCACCAA
.....<<<<<<....>>>>>>.....
X06641.1 0.00 ACAACGGCUCUUUUUAGAGCCACCAA
.....<<<<<<....>>>>>>.....
X06642.1 0.00 ACAACGGCUCUUUUAAGAGCCACCAA
.....<<<<<<....>>>>>>.....
X07772.1 0.00 AAAACGGCUCUAUUCAGAGCCACCAC
.....<<<<<<....>>>>>>.....
X13236.1 0.00 CAAAAGGUCCUUUUCAGGACCACUCA
.....<<<<<<....>>>>>>.....
X13554.1 0.00 ACAAAGGCCCUUUUCAGGGCCCCCAA
.....<<<<<<....>>>>>>.....
X14215.1 0.00 AAAACGGCCCUUUUCAGGGCCACAAU
.....<<<<<<....>>>>>>.....
X14730.1 0.00 ACAAAGGCUCUUUUUAGAGCCACCCA
.....<<<<<<....>>>>>>.....
X15634.1 0.00 CCAACGGCCCUCUUUAGGGCCACAAA
.....<<<<<<....>>>>>>.....
X16496.1 0.00 CCAAAGGCUCUUUUCAGAGCCAACCA
.....<<<<<<....>>>>>>.....
X17072.1 0.00 CAAAAGGCCCUUUUCAGGGCCACAAA
.....<<<<<<....>>>>>>.....
X57128.1 0.00 GAAAAGGCUCUUUUCAGAGCCACUCA
.....<<<<<<....>>>>>>.....
X57130.1 0.00 CAAACGGCUCUUUUAAGAGCCACCUA
.....<<<<<<....>>>>>>.....
X58895.1 0.00 CACACGGCUCUUUUUAGAGCCACAUA
.....<<<<<<....>>>>>>.....
X60482.1 0.00 CCAACGGCCCUUUUCAGGGCCACCUA
.....<<<<<<....>>>>>>.....
X60483.1 0.00 CAAAAGGCCCUUUUUAGGGCCCCCAC
.....<<<<<<....>>>>>>.....
X60484.1 0.00 UAAAAGGCCCUUUUCAGGGCCACCCU
.....<<<<<<....>>>>>>.....
X71389.1 0.00 ACAAAGGCUCUUCUAAGAGCCCCCAU
.....<<<<<<....>>>>>>.....
X71390.1 0.00 ACAAAGGCUCUUCUAAGAGUCCCCAU
.....<<<<<<....>>>>>>.....
X72803.1 0.00 UAAAAGGUCCUUUUCAGGACCACAAA
.....<<<<<<....>>>>>>.....
X72929.1 0.00 UCAAAGGCUCUUUUCAGAGCCACCAC
.....<<<<<<....>>>>>>.....
X72950.1 0.00 ACAAAGGUUCUUUUCAGAGCCACUAA
.....<<<<<<....>>>>>>.....
X80330.1 0.00 AAAACGGCUCUUUUCAGAGCCACCCA
.....<<<<<<....>>>>>>.....
X83548.1 0.00 UCAAAGGCCCUUCUCAGGGCCACCCA
.....<<<<<<....>>>>>>.....
X83550.1 0.00 CAAAAGGCUCUUUUCAGAGCCCCUCA
.....<<<<<<....>>>>>>.....
Y12290.1 0.00 CCAACGGCUCUUUUCAGAGCCACCAA
.....<<<<<<....>>>>>>.....
Y12291.1 0.00 CAAAAGGCUCUUUUCAGAGCCACCAC
.....<<<<<<....>>>>>>.....
Z30940.1 0.00 AAAAAGGCUCUUUUCAGAGCCACCCA
.....<<<<<<....>>>>>>.....
Z35401.1 0.00 ACAAAGGCCCUUUUAAGGGCCACCAC
.....<<<<<<....>>>>>>.....
Z38128.1 0.00 CAAACGGCUCUUUUCAGAGCCACCCA
.....<<<<<<....>>>>>>.....
Z46261.1 0.00 GCAAAGGCUCUUUUCAGAGCCACCAC
.....<<<<<<....>>>>>>.....
Z49861.1 0.00 CCAAAGGCUCUUUUAAGAGCCACCCA
.....<<<<<<....>>>>>>.....