Seq ID Score (bits) Sequence
AF007904.1 20.90 AAAACGGUCCUUAUCAGGACCAAACA
_____<<<<<<....>>>>>>_____
AY028698.1 20.90 CCAACGGUCCUUAUCAGGACCACUAU
_____<<<<<<....>>>>>>_____
AY064471.1 26.52 AAACCGGCCCUUUUAAGGGCCACAAC
_____<<<<<<....>>>>>>_____
BC016336.1 25.52 AAAAAGGCCCUUUUUAGGGCCCCUAA
_____<<<<<<....>>>>>>_____
BC020884.1 27.63 CAAAAGGCCCUUUUCAGGGCCCCCAA
_____<<<<<<....>>>>>>_____
J00985.1 26.52 ACAACGGCCCUUUUAAGGGCCACAAA
_____<<<<<<....>>>>>>_____
J00986.1 26.52 AAAACGGCCCUUUUAAGGGCCACCAA
_____<<<<<<....>>>>>>_____
J00987.1 28.67 CCCAAGGCUCUUUUCAGAGCCCCCCA
_____<<<<<<....>>>>>>_____
L19706.1 26.55 UAAAAGGCUCUUUUUAGAGCCACUAA
_____<<<<<<....>>>>>>_____
L19778.1 24.24 CCAACGGCUCUUUUCAGGGCCACCCA
_____<<<<<<....>>>>>>_____
M10557.1 27.63 ACAACGGCCCUUUUCAGGGCCACACA
_____<<<<<<....>>>>>>_____
M60746.1 25.50 CCAAAGGCUCUUCUCAGAGCCAACCA
_____<<<<<<....>>>>>>_____
M60747.1 28.67 UAAACGGCUCUUUUCAGAGCCACCCA
_____<<<<<<....>>>>>>_____
S49118.1 28.67 ACCCCGGCUCUUUUCAGAGCCAAAAC
_____<<<<<<....>>>>>>_____
U37575.1 28.67 CAAACGGCUCUUUUCAGAGCCCCCAA
_____<<<<<<....>>>>>>_____
U37576.1 25.50 CCAAAGGCUCUUCUCAGAGCCACCCA
_____<<<<<<....>>>>>>_____
U62673.1 27.55 AAAAAGGCUCUUUUAAGAGCCACCAA
_____<<<<<<....>>>>>>_____
V01357.1 24.46 UCAACGGCCCUUAUCAGGGCCACCAA
_____<<<<<<....>>>>>>_____
X00224.1 28.67 CCAAAGGCUCUUUUCAGAGCCCCCCA
_____<<<<<<....>>>>>>_____
X01685.1 27.55 AAAACGGCUCUUUUAAGAGCCACCUC
_____<<<<<<....>>>>>>_____
X01752.1 27.55 CCAACGGCUCUUUUAAGAGCCACCCA
_____<<<<<<....>>>>>>_____
X02622.1 28.67 CCCAAGGCUCUUUUCAGAGCCACCAC
_____<<<<<<....>>>>>>_____
X02624.1 27.55 CAAAAGGCUCUUUUAAGAGCCACCCA
_____<<<<<<....>>>>>>_____
X02916.1 27.55 CCCAAGGCUCUUUUAAGAGCCACCCA
_____<<<<<<....>>>>>>_____
X03017.1 27.55 ACAAAGGCUCUUUUAAGAGCCCCCAC
_____<<<<<<....>>>>>>_____
X03018.1 27.55 ACCAAGGCUCUUUUAAGAGCCACCAC
_____<<<<<<....>>>>>>_____
X03952.1 26.55 CCAACGGCUCUUUUUAGAGCCACCAC
_____<<<<<<....>>>>>>_____
X04384.1 25.50 CAAACGGCUCUUAUCAGAGCCACCAA
_____<<<<<<....>>>>>>_____
X04488.1 25.50 CCAACGGCUCUUAUCAGAGCCACCCA
_____<<<<<<....>>>>>>_____
X05620.1 28.67 CAAACGGCUCUUUUCAGAGCCAACAC
_____<<<<<<....>>>>>>_____
X05862.1 28.67 ACCAAGGCUCUUUUCAGAGCCACUCA
_____<<<<<<....>>>>>>_____
X06639.1 27.55 AAACCGGCUCUUUUAAGAGCCACCAA
_____<<<<<<....>>>>>>_____
X06641.1 26.55 ACAACGGCUCUUUUUAGAGCCACCAA
_____<<<<<<....>>>>>>_____
X06642.1 27.55 ACAACGGCUCUUUUAAGAGCCACCAA
_____<<<<<<....>>>>>>_____
X07772.1 23.71 AAAACGGCUCUAUUCAGAGCCACCAC
_____<<<<<<....>>>>>>_____
X13236.1 24.07 CAAAAGGUCCUUUUCAGGACCACUCA
_____<<<<<<....>>>>>>_____
X13554.1 27.63 ACAAAGGCCCUUUUCAGGGCCCCCAA
_____<<<<<<....>>>>>>_____
X14215.1 27.63 AAAACGGCCCUUUUCAGGGCCACAAU
_____<<<<<<....>>>>>>_____
X14730.1 26.55 ACAAAGGCUCUUUUUAGAGCCACCCA
_____<<<<<<....>>>>>>_____
X15634.1 20.56 CCAACGGCCCUCUUUAGGGCCACAAA
_____<<<<<<....>>>>>>_____
X16496.1 28.67 CCAAAGGCUCUUUUCAGAGCCAACCA
_____<<<<<<....>>>>>>_____
X17072.1 27.63 CAAAAGGCCCUUUUCAGGGCCACAAA
_____<<<<<<....>>>>>>_____
X57128.1 28.67 GAAAAGGCUCUUUUCAGAGCCACUCA
_____<<<<<<....>>>>>>_____
X57130.1 27.55 CAAACGGCUCUUUUAAGAGCCACCUA
_____<<<<<<....>>>>>>_____
X58895.1 26.55 CACACGGCUCUUUUUAGAGCCACAUA
_____<<<<<<....>>>>>>_____
X60482.1 27.63 CCAACGGCCCUUUUCAGGGCCACCUA
_____<<<<<<....>>>>>>_____
X60483.1 25.52 CAAAAGGCCCUUUUUAGGGCCCCCAC
_____<<<<<<....>>>>>>_____
X60484.1 27.63 UAAAAGGCCCUUUUCAGGGCCACCCU
_____<<<<<<....>>>>>>_____
X71389.1 24.38 ACAAAGGCUCUUCUAAGAGCCCCCAU
_____<<<<<<....>>>>>>_____
X71390.1 19.41 ACAAAGGCUCUUCUAAGAGUCCCCAU
_____<<<<<<....>>>>>>_____
X72803.1 24.07 UAAAAGGUCCUUUUCAGGACCACAAA
_____<<<<<<....>>>>>>_____
X72929.1 28.67 UCAAAGGCUCUUUUCAGAGCCACCAC
_____<<<<<<....>>>>>>_____
X72950.1 23.78 ACAAAGGUUCUUUUCAGAGCCACUAA
_____<<<<<<....>>>>>>_____
X80330.1 28.67 AAAACGGCUCUUUUCAGAGCCACCCA
_____<<<<<<....>>>>>>_____
X83548.1 24.46 UCAAAGGCCCUUCUCAGGGCCACCCA
_____<<<<<<....>>>>>>_____
X83550.1 28.67 CAAAAGGCUCUUUUCAGAGCCCCUCA
_____<<<<<<....>>>>>>_____
Y12290.1 28.67 CCAACGGCUCUUUUCAGAGCCACCAA
_____<<<<<<....>>>>>>_____
Y12291.1 28.67 CAAAAGGCUCUUUUCAGAGCCACCAC
_____<<<<<<....>>>>>>_____
Z30940.1 28.67 AAAAAGGCUCUUUUCAGAGCCACCCA
_____<<<<<<....>>>>>>_____
Z35401.1 26.52 ACAAAGGCCCUUUUAAGGGCCACCAC
_____<<<<<<....>>>>>>_____
Z38128.1 28.67 CAAACGGCUCUUUUCAGAGCCACCCA
_____<<<<<<....>>>>>>_____
Z46261.1 28.67 GCAAAGGCUCUUUUCAGAGCCACCAC
_____<<<<<<....>>>>>>_____
Z49861.1 27.55 CCAAAGGCUCUUUUAAGAGCCACCCA
_____<<<<<<....>>>>>>_____