Seq ID Score (bits) Sequence
AF007904.1 0.00 AAAACGGUCCUUAUCAGGACCAAACA
.......<<<<....>>>>.......
AY028698.1 0.00 CCAACGGUCCUUAUCAGGACCACUAU
.....<.<<<<....>>>>...>.<>
AY064471.1 0.00 AAACCGGCCCUUUUAAGGGCCACAAC
.....<.<<<<.<.>>>>>...>...
BC016336.1 0.00 AAAAAGGCCCUUUUUAGGGCCCCUAA
....<<.<<<<....>>>>...>>..
BC020884.1 0.00 CAAAAGGCCCUUUUCAGGGCCCCCAA
.....<.<<<<....>>>>...>...
J00985.1 0.00 ACAACGGCCCUUUUAAGGGCCACAAA
.....<.<<<<.<.>>>>>...>...
J00986.1 0.00 AAAACGGCCCUUUUAAGGGCCACCAA
.....<.<<<<.<.>>>>>...>...
J00987.1 0.00 CCCAAGGCUCUUUUCAGAGCCCCCCA
.....<.<<<<....>>>>...>...
L19706.1 0.00 UAAAAGGCUCUUUUUAGAGCCACUAA
<..><<.<<<<....>>>>...>>..
L19778.1 0.00 CCAACGGCUCUUUUCAGGGCCACCCA
.....<.<<<<....>>>>...>...
M10557.1 0.00 ACAACGGCCCUUUUCAGGGCCACACA
.....<.<<<<....>>>>...>...
M60746.1 0.00 CCAAAGGCUCUUCUCAGAGCCAACCA
.......<<<<....>>>>.......
M60747.1 0.00 UAAACGGCUCUUUUCAGAGCCACCCA
<..>.<.<<<<....>>>>...>...
S49118.1 0.00 ACCCCGGCUCUUUUCAGAGCCAAAAC
.......<<<<....>>>>.......
U37575.1 0.00 CAAACGGCUCUUUUCAGAGCCCCCAA
.....<.<<<<....>>>>...>...
U37576.1 0.00 CCAAAGGCUCUUCUCAGAGCCACCCA
.....<.<<<<....>>>>...>...
U62673.1 0.00 AAAAAGGCUCUUUUAAGAGCCACCAA
.....<.<<<<.<.>>>>>...>...
V01357.1 0.00 UCAACGGCCCUUAUCAGGGCCACCAA
<..>.<.<<<<....>>>>...>...
X00224.1 0.00 CCAAAGGCUCUUUUCAGAGCCCCCCA
.....<.<<<<....>>>>...>...
X01685.1 0.00 AAAACGGCUCUUUUAAGAGCCACCUC
.....<.<<<<.<.>>>>>...>...
X01752.1 0.00 CCAACGGCUCUUUUAAGAGCCACCCA
.....<.<<<<.<.>>>>>...>...
X02622.1 0.00 CCCAAGGCUCUUUUCAGAGCCACCAC
.....<.<<<<....>>>>...>...
X02624.1 0.00 CAAAAGGCUCUUUUAAGAGCCACCCA
.....<.<<<<.<.>>>>>...>...
X02916.1 0.00 CCCAAGGCUCUUUUAAGAGCCACCCA
.....<.<<<<.<.>>>>>...>...
X03017.1 0.00 ACAAAGGCUCUUUUAAGAGCCCCCAC
.....<.<<<<.<.>>>>>...>...
X03018.1 0.00 ACCAAGGCUCUUUUAAGAGCCACCAC
.....<.<<<<.<.>>>>>...>...
X03952.1 0.00 CCAACGGCUCUUUUUAGAGCCACCAC
.....<.<<<<....>>>>...>...
X04384.1 0.00 CAAACGGCUCUUAUCAGAGCCACCAA
.....<.<<<<....>>>>...>...
X04488.1 0.00 CCAACGGCUCUUAUCAGAGCCACCCA
.....<.<<<<....>>>>...>...
X05620.1 0.00 CAAACGGCUCUUUUCAGAGCCAACAC
.......<<<<....>>>>.......
X05862.1 0.00 ACCAAGGCUCUUUUCAGAGCCACUCA
....<<.<<<<....>>>>...>>..
X06639.1 0.00 AAACCGGCUCUUUUAAGAGCCACCAA
.....<.<<<<.<.>>>>>...>...
X06641.1 0.00 ACAACGGCUCUUUUUAGAGCCACCAA
.....<.<<<<....>>>>...>...
X06642.1 0.00 ACAACGGCUCUUUUAAGAGCCACCAA
.....<.<<<<.<.>>>>>...>...
X07772.1 0.00 AAAACGGCUCUAUUCAGAGCCACCAC
.....<.<<<<....>>>>...>...
X13236.1 0.00 CAAAAGGUCCUUUUCAGGACCACUCA
....<<.<<<<....>>>>...>>..
X13554.1 0.00 ACAAAGGCCCUUUUCAGGGCCCCCAA
.....<.<<<<....>>>>...>...
X14215.1 0.00 AAAACGGCCCUUUUCAGGGCCACAAU
.....<.<<<<....>>>>...>.<>
X14730.1 0.00 ACAAAGGCUCUUUUUAGAGCCACCCA
.....<.<<<<....>>>>...>...
X15634.1 0.00 CCAACGGCCCUCUUUAGGGCCACAAA
.....<.<<<<....>>>>...>...
X16496.1 0.00 CCAAAGGCUCUUUUCAGAGCCAACCA
.......<<<<....>>>>.......
X17072.1 0.00 CAAAAGGCCCUUUUCAGGGCCACAAA
.....<.<<<<....>>>>...>...
X57128.1 0.00 GAAAAGGCUCUUUUCAGAGCCACUCA
....<<.<<<<....>>>>...>>..
X57130.1 0.00 CAAACGGCUCUUUUAAGAGCCACCUA
.....<.<<<<.<.>>>>>...>.<>
X58895.1 0.00 CACACGGCUCUUUUUAGAGCCACAUA
.....<.<<<<....>>>>...>.<>
X60482.1 0.00 CCAACGGCCCUUUUCAGGGCCACCUA
.....<.<<<<....>>>>...>.<>
X60483.1 0.00 CAAAAGGCCCUUUUUAGGGCCCCCAC
.....<.<<<<....>>>>...>...
X60484.1 0.00 UAAAAGGCCCUUUUCAGGGCCACCCU
<..>.<.<<<<....>>>>...>...
X71389.1 0.00 ACAAAGGCUCUUCUAAGAGCCCCCAU
.....<.<<<<....>>>>...>.<>
X71390.1 0.00 ACAAAGGCUCUUCUAAGAGUCCCCAU
.....<.<<<<....>>>>...>.<>
X72803.1 0.00 UAAAAGGUCCUUUUCAGGACCACAAA
<..>.<.<<<<....>>>>...>...
X72929.1 0.00 UCAAAGGCUCUUUUCAGAGCCACCAC
<..>.<.<<<<....>>>>...>...
X72950.1 0.00 ACAAAGGUUCUUUUCAGAGCCACUAA
....<<.<<<<....>>>>...>>..
X80330.1 0.00 AAAACGGCUCUUUUCAGAGCCACCCA
.....<.<<<<....>>>>...>...
X83548.1 0.00 UCAAAGGCCCUUCUCAGGGCCACCCA
<..>.<.<<<<....>>>>...>...
X83550.1 0.00 CAAAAGGCUCUUUUCAGAGCCCCUCA
....<<.<<<<....>>>>...>>..
Y12290.1 0.00 CCAACGGCUCUUUUCAGAGCCACCAA
.....<.<<<<....>>>>...>...
Y12291.1 0.00 CAAAAGGCUCUUUUCAGAGCCACCAC
.....<.<<<<....>>>>...>...
Z30940.1 0.00 AAAAAGGCUCUUUUCAGAGCCACCCA
.....<.<<<<....>>>>...>...
Z35401.1 0.00 ACAAAGGCCCUUUUAAGGGCCACCAC
.....<.<<<<.<.>>>>>...>...
Z38128.1 0.00 CAAACGGCUCUUUUCAGAGCCACCCA
.....<.<<<<....>>>>...>...
Z46261.1 0.00 GCAAAGGCUCUUUUCAGAGCCACCAC
.....<.<<<<....>>>>...>...
Z49861.1 0.00 CCAAAGGCUCUUUUAAGAGCCACCCA
.....<.<<<<.<.>>>>>...>...